ID: 1171396224

View in Genome Browser
Species Human (GRCh38)
Location 20:24835468-24835490
Sequence GAGACAGGAGAGAGGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396215_1171396224 1 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396214_1171396224 7 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396216_1171396224 0 Left 1171396216 20:24835445-24835467 CCGGCCCTTCACCATGATCCAGT No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396212_1171396224 20 Left 1171396212 20:24835425-24835447 CCAACTGCTGGCTCCAGGACCCG No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396209_1171396224 28 Left 1171396209 20:24835417-24835439 CCACTGTCCCAACTGCTGGCTCC No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396218_1171396224 -5 Left 1171396218 20:24835450-24835472 CCTTCACCATGATCCAGTGAGAC No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396211_1171396224 21 Left 1171396211 20:24835424-24835446 CCCAACTGCTGGCTCCAGGACCC No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396217_1171396224 -4 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396224 Original CRISPR GAGACAGGAGAGAGGTTGGC AGG Intergenic
No off target data available for this crispr