ID: 1171396228

View in Genome Browser
Species Human (GRCh38)
Location 20:24835484-24835506
Sequence TGGCAGGGTTGAACGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396214_1171396228 23 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396217_1171396228 12 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396218_1171396228 11 Left 1171396218 20:24835450-24835472 CCTTCACCATGATCCAGTGAGAC No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396215_1171396228 17 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396216_1171396228 16 Left 1171396216 20:24835445-24835467 CCGGCCCTTCACCATGATCCAGT No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396222_1171396228 -2 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396220_1171396228 5 Left 1171396220 20:24835456-24835478 CCATGATCCAGTGAGACAGGAGA No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396228 Original CRISPR TGGCAGGGTTGAACGGAGGT AGG Intergenic
No off target data available for this crispr