ID: 1171396231

View in Genome Browser
Species Human (GRCh38)
Location 20:24835500-24835522
Sequence AGGTAGGAAAAGGAGCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396220_1171396231 21 Left 1171396220 20:24835456-24835478 CCATGATCCAGTGAGACAGGAGA No data
Right 1171396231 20:24835500-24835522 AGGTAGGAAAAGGAGCGAGGAGG No data
1171396218_1171396231 27 Left 1171396218 20:24835450-24835472 CCTTCACCATGATCCAGTGAGAC No data
Right 1171396231 20:24835500-24835522 AGGTAGGAAAAGGAGCGAGGAGG No data
1171396222_1171396231 14 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396231 20:24835500-24835522 AGGTAGGAAAAGGAGCGAGGAGG No data
1171396217_1171396231 28 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396231 20:24835500-24835522 AGGTAGGAAAAGGAGCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396231 Original CRISPR AGGTAGGAAAAGGAGCGAGG AGG Intergenic
No off target data available for this crispr