ID: 1171396639

View in Genome Browser
Species Human (GRCh38)
Location 20:24838720-24838742
Sequence AAGAAGGCTGGCCCTGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396632_1171396639 30 Left 1171396632 20:24838667-24838689 CCAGAAGGAGGTAAAGGGTGATT No data
Right 1171396639 20:24838720-24838742 AAGAAGGCTGGCCCTGCACAAGG No data
1171396635_1171396639 3 Left 1171396635 20:24838694-24838716 CCACATGGACTCTGGTTGTCTTC No data
Right 1171396639 20:24838720-24838742 AAGAAGGCTGGCCCTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396639 Original CRISPR AAGAAGGCTGGCCCTGCACA AGG Intergenic
No off target data available for this crispr