ID: 1171396976

View in Genome Browser
Species Human (GRCh38)
Location 20:24841335-24841357
Sequence TATCCCAAGCGAATTAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396973_1171396976 11 Left 1171396973 20:24841301-24841323 CCTTTGCAGCAACAGGGATGCAG No data
Right 1171396976 20:24841335-24841357 TATCCCAAGCGAATTAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396976 Original CRISPR TATCCCAAGCGAATTAGTGC AGG Intergenic
No off target data available for this crispr