ID: 1171402115

View in Genome Browser
Species Human (GRCh38)
Location 20:24880477-24880499
Sequence GGCACAGGGCCTTTCTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171402108_1171402115 15 Left 1171402108 20:24880439-24880461 CCAACACCATGACGAGAAAAAAG No data
Right 1171402115 20:24880477-24880499 GGCACAGGGCCTTTCTTTAAGGG No data
1171402107_1171402115 25 Left 1171402107 20:24880429-24880451 CCATTAAAAGCCAACACCATGAC No data
Right 1171402115 20:24880477-24880499 GGCACAGGGCCTTTCTTTAAGGG No data
1171402109_1171402115 9 Left 1171402109 20:24880445-24880467 CCATGACGAGAAAAAAGAAAAGC No data
Right 1171402115 20:24880477-24880499 GGCACAGGGCCTTTCTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171402115 Original CRISPR GGCACAGGGCCTTTCTTTAA GGG Intergenic
No off target data available for this crispr