ID: 1171402368

View in Genome Browser
Species Human (GRCh38)
Location 20:24883111-24883133
Sequence AAAAGCAACCACTTTTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171402366_1171402368 14 Left 1171402366 20:24883074-24883096 CCTTCTTGGGAGCTAGGCATTGA No data
Right 1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG No data
1171402365_1171402368 15 Left 1171402365 20:24883073-24883095 CCCTTCTTGGGAGCTAGGCATTG No data
Right 1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171402368 Original CRISPR AAAAGCAACCACTTTTAAGT GGG Intergenic
No off target data available for this crispr