ID: 1171407025

View in Genome Browser
Species Human (GRCh38)
Location 20:24918350-24918372
Sequence CCTAGCCTGCTCCGCAGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171407025_1171407040 9 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407040 20:24918382-24918404 AGGTCCCGGCACAGGGGAGGGGG No data
1171407025_1171407048 27 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407048 20:24918400-24918422 GGGGGGCGGGGGCGCTGCCAAGG No data
1171407025_1171407034 1 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407034 20:24918374-24918396 ACTGGGGCAGGTCCCGGCACAGG No data
1171407025_1171407046 15 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407046 20:24918388-24918410 CGGCACAGGGGAGGGGGGCGGGG No data
1171407025_1171407038 7 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407038 20:24918380-24918402 GCAGGTCCCGGCACAGGGGAGGG No data
1171407025_1171407035 2 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407035 20:24918375-24918397 CTGGGGCAGGTCCCGGCACAGGG No data
1171407025_1171407037 6 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407037 20:24918379-24918401 GGCAGGTCCCGGCACAGGGGAGG No data
1171407025_1171407039 8 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407039 20:24918381-24918403 CAGGTCCCGGCACAGGGGAGGGG No data
1171407025_1171407033 -5 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407033 20:24918368-24918390 CTAGGGACTGGGGCAGGTCCCGG No data
1171407025_1171407036 3 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407036 20:24918376-24918398 TGGGGCAGGTCCCGGCACAGGGG No data
1171407025_1171407043 13 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407043 20:24918386-24918408 CCCGGCACAGGGGAGGGGGGCGG No data
1171407025_1171407047 16 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407047 20:24918389-24918411 GGCACAGGGGAGGGGGGCGGGGG No data
1171407025_1171407045 14 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407045 20:24918387-24918409 CCGGCACAGGGGAGGGGGGCGGG No data
1171407025_1171407041 10 Left 1171407025 20:24918350-24918372 CCGCCGCTGCGGAGCAGGCTAGG No data
Right 1171407041 20:24918383-24918405 GGTCCCGGCACAGGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171407025 Original CRISPR CCTAGCCTGCTCCGCAGCGG CGG (reversed) Intergenic
No off target data available for this crispr