ID: 1171407409

View in Genome Browser
Species Human (GRCh38)
Location 20:24920851-24920873
Sequence GCTCATTTAAGACCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 3, 1: 10, 2: 33, 3: 24, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171407405_1171407409 0 Left 1171407405 20:24920828-24920850 CCGGAGAAACTCCTCCCTTGGCA No data
Right 1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG 0: 3
1: 10
2: 33
3: 24
4: 148
1171407401_1171407409 30 Left 1171407401 20:24920798-24920820 CCAGAGTAAACAAGAGAGGAGTT No data
Right 1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG 0: 3
1: 10
2: 33
3: 24
4: 148
1171407403_1171407409 3 Left 1171407403 20:24920825-24920847 CCTCCGGAGAAACTCCTCCCTTG No data
Right 1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG 0: 3
1: 10
2: 33
3: 24
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171407409 Original CRISPR GCTCATTTAAGACCCAAAAC TGG Intergenic
900898998 1:5504162-5504184 GCTCATTCCAGACCCAGCACTGG - Intergenic
901562449 1:10083391-10083413 GTTCATTAAAGACTCAAAATTGG - Intronic
902300113 1:15495636-15495658 TCTTATTTAGGAACCAAAACGGG - Intronic
904491965 1:30866600-30866622 GCTCATTTAAGCCCCAGGTCTGG - Intergenic
904809496 1:33154157-33154179 GCTCATTTAAGATCTAAAGATGG + Intronic
905584718 1:39107172-39107194 GCAGAATTAAGACCCAAAATAGG + Intronic
908029018 1:59980443-59980465 GCTCTTCTAAGACTCAAAACAGG - Intergenic
908969820 1:69814580-69814602 GCTCAGTTAAGTGACAAAACTGG + Intronic
909226416 1:73030172-73030194 ATTTATTTAAGACTCAAAACAGG + Intergenic
911177120 1:94827922-94827944 CCACATTTAAGACCCAAAGGCGG + Intronic
912771363 1:112466589-112466611 GCAAATTTAAGACTTAAAACTGG + Intronic
916160885 1:161913085-161913107 GCTCATTTATAATCCACAACTGG - Intronic
916680166 1:167096457-167096479 GCTCAAATAAGTTCCAAAACAGG + Intronic
917343682 1:174006647-174006669 GCTCAGATTAAACCCAAAACAGG - Intronic
919460933 1:197875948-197875970 GCTAATGTAAGACCTAAAACTGG - Intergenic
920166353 1:204038949-204038971 GCTCTTTTCTTACCCAAAACTGG - Intergenic
920749168 1:208657964-208657986 TCTCATTTAAGGCTCACAACAGG + Intergenic
920776471 1:208943036-208943058 GCTCATTTCAGAGGCAAAAGGGG + Intergenic
922971171 1:229740317-229740339 GCTCATTTGTGCCCCAAACCTGG - Intergenic
923017053 1:230134969-230134991 TCTCATTTAAGCCTCACAACAGG - Intronic
1063110600 10:3033601-3033623 GCTCAATTCAAACCCAAATCTGG + Intergenic
1064158581 10:12924023-12924045 TCTCCTTTAAGGCACAAAACTGG - Intronic
1064394989 10:14974534-14974556 GCTGGTTTACGACCCAAAACGGG - Intronic
1064396037 10:14982663-14982685 GCTCGTCTACGACCCAAAACGGG - Intronic
1064397736 10:14994850-14994872 GCTCGTTTAGGACCCTAAACGGG - Intergenic
1065518413 10:26547743-26547765 GTTAATATATGACCCAAAACTGG - Intronic
1066332285 10:34437591-34437613 GTTAATTTAAGACCCCAAACTGG - Intronic
1066389924 10:34970339-34970361 GCTCTTTTATGACCCAAAACTGG + Intergenic
1068121638 10:52786785-52786807 GATGATTTAAGGCCCCAAACAGG + Intergenic
1071098150 10:82003259-82003281 GCTCATTTAAGATACACAATTGG + Intronic
1075226118 10:120630767-120630789 GCTCTTTTCAGACCTAAAAAGGG - Intergenic
1075433736 10:122415344-122415366 CCACATTTAAGACCCAGAATTGG - Intronic
1077589490 11:3480586-3480608 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1077907726 11:6546950-6546972 GCTTATTTAAGATCCAGAATCGG + Exonic
1078999495 11:16739198-16739220 GAACATTTAGAACCCAAAACAGG - Intronic
1079294804 11:19223492-19223514 GCTCCTTTAAGACCCTAACCAGG + Intergenic
1084228214 11:67730827-67730849 GCTCGTTTACCAACCAAAACGGG - Intergenic
1084245211 11:67852360-67852382 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1084261617 11:67982515-67982537 GCTCGTTTACGACCCAAAACGGG - Intergenic
1084807014 11:71586035-71586057 GCTTGTTTATGACCCAAAATGGG + Intronic
1084811026 11:71611598-71611620 GCTTGTTTACGACCCAAAACGGG + Intergenic
1084827477 11:71742218-71742240 GCTCGTTTAAGACCCAAAACGGG + Intergenic
1084844096 11:71886049-71886071 GCTCGTTTACGACCCAAAAGGGG + Intronic
1084846954 11:71908506-71908528 GCTCGTTTACAACCCAAAACGGG + Intronic
1085871659 11:80357445-80357467 GCTCTTTAAAGACCAAAAAAGGG + Intergenic
1086454309 11:86946373-86946395 GCTCATATAGGACCCCAAAAAGG + Exonic
1092415780 12:8289492-8289514 GTTCGTTTAAGACCCAAAACGGG - Intergenic
1092432904 12:8423077-8423099 GCTCGTTTATGACCTCAAACGGG - Intergenic
1092435499 12:8443706-8443728 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1098714567 12:73813751-73813773 ACTCCATTAAGACCCAGAACAGG + Intergenic
1099736984 12:86580840-86580862 ACTCATTTAAGAGCAAAAAAGGG + Intronic
1100912229 12:99378107-99378129 GATCATTTAAGAACCACAAAAGG + Intronic
1104573140 12:129942845-129942867 GCTTTTTTAAGAAACAAAACAGG - Intergenic
1104641974 12:130473259-130473281 GCTCATTTAGGGGCCAACACAGG + Intronic
1104998932 12:132676102-132676124 GTTCATTGAAGACACAAAAGGGG + Exonic
1106634795 13:31516732-31516754 GCTGATACAAGACACAAAACAGG - Intergenic
1107490988 13:40879773-40879795 GCTCATTTATGGCCTAAGACTGG - Intergenic
1107544670 13:41424605-41424627 GCTCGTTTACGACCCAAAACGGG - Intergenic
1108833771 13:54514688-54514710 CCACATGGAAGACCCAAAACTGG + Intergenic
1109558084 13:64007548-64007570 TCTCATTTAAAAAACAAAACTGG - Intergenic
1109802531 13:67398756-67398778 GCTCACTTATGGCCCAAGACTGG + Intergenic
1110829501 13:80013856-80013878 GCTCCTTGAAAGCCCAAAACTGG - Intergenic
1110990375 13:82035527-82035549 ACTCATTTAACACCCAGAATGGG - Intergenic
1111025297 13:82512871-82512893 CTTCTTTTAAGACCAAAAACAGG - Intergenic
1111144518 13:84163454-84163476 GCTCTTTTAGGAACCAAAAGGGG - Intergenic
1115530292 14:34320864-34320886 GCTCATTTAAGAGCCCAGACTGG + Intronic
1115876611 14:37868549-37868571 GCTTACTTAAAACCCAAAACAGG - Intronic
1115906063 14:38204285-38204307 GCTCATTTAAGGATCAACACAGG + Intergenic
1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG + Intergenic
1119429287 14:74555470-74555492 GCTCTTCTAGGACCCAAGACAGG + Intronic
1120890208 14:89484835-89484857 GCACCTTTAAGACCCAGGACAGG + Intronic
1121687083 14:95843820-95843842 TCTCATTTAATCCTCAAAACAGG - Intergenic
1122725261 14:103746372-103746394 GCTCATGGAAGATCCAAATCCGG - Exonic
1127861968 15:63001598-63001620 ACACATTTAAAACCAAAAACAGG + Intergenic
1131952458 15:97695380-97695402 GCTCAGCTAAGACCCAGCACAGG - Intergenic
1133428294 16:5712576-5712598 GCTCACTTAATTCCCATAACAGG + Intergenic
1133796824 16:9053046-9053068 GCTCATATAAAGTCCAAAACTGG + Intergenic
1133903266 16:9997132-9997154 GCTGAGTTAAAACTCAAAACAGG + Intronic
1140754991 16:78059004-78059026 GCTCGTTTAAGACCCAAAACTGG - Intronic
1145865341 17:28237694-28237716 GCTCGTTTAAGACACAAAACTGG - Intergenic
1148938630 17:51186923-51186945 GCTCATATAAGCCCAAACACTGG + Intronic
1150201909 17:63365946-63365968 GCTCATTTTAGACAGAAAAGTGG - Intronic
1150470149 17:65430483-65430505 GCTCTGTTAGGACCCAGAACTGG - Intergenic
1151109327 17:71656204-71656226 ACTCATTTAATCCTCAAAACAGG - Intergenic
1156288455 18:35722375-35722397 GCTCCTTTAAGACCCAGGAATGG + Intergenic
1158291761 18:55951966-55951988 GCTCACTTATGGCCCAAGACTGG + Intergenic
1158592540 18:58789903-58789925 GTTCATTTAATCTCCAAAACAGG + Intergenic
1158917328 18:62147352-62147374 TCTCATTTAGGACCTAAAAAGGG - Intronic
1162024698 19:7887484-7887506 GCTCATCTAAGACCCAGCTCAGG + Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1162652936 19:12104642-12104664 GCTCATTAAAGAACCACTACAGG - Intronic
1163471728 19:17501087-17501109 GCTCATTGAAGCCCTAAGACAGG - Intronic
1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG + Intergenic
1163943664 19:20516989-20517011 GCTCACTTACGGCCCAAGACTGG - Intergenic
1163966844 19:20753992-20754014 GCTCATTTAAGACCCAAAACAGG - Intronic
1164554491 19:29240778-29240800 TCTGATTTAAGACCCAGAAATGG + Intergenic
1165716422 19:38048781-38048803 CCTCAGTTAACACCCAAAAAAGG + Intronic
927656179 2:24948675-24948697 GCTCCTCAAAGAGCCAAAACTGG + Intronic
932312810 2:70757528-70757550 GCTAATTTAAGACACAAATGAGG + Intronic
932349419 2:71020415-71020437 GCTCCTTTACGGCCCAAAACGGG + Intergenic
932353002 2:71046904-71046926 GCTGGTTTATGACCCGAAACTGG + Intergenic
937844935 2:126569464-126569486 TCTAAATAAAGACCCAAAACAGG + Intergenic
939698631 2:145360651-145360673 GCTCATTTAAGTTCCCAGACTGG + Intergenic
940088021 2:149883387-149883409 TCTGATGTATGACCCAAAACTGG + Intergenic
940871700 2:158866200-158866222 GCTCTTTTACGACCCAAAACGGG + Intergenic
940873924 2:158882203-158882225 GCTCATTTATGACTCAAAACGGG + Intergenic
946638201 2:221754041-221754063 GCTCATTTACGGCCCATACCAGG + Intergenic
947594497 2:231402327-231402349 GCTTGTTTAAGACCCAAAACTGG + Intergenic
1169037938 20:2469131-2469153 TCTCATTTAATCCCCAAAATTGG + Intronic
1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG + Intergenic
1175974591 20:62704159-62704181 GCTCACTTGAGGCCCAAAACTGG + Intergenic
1181863225 22:25835337-25835359 CCTCATCTAAGACCCAGAAAAGG - Exonic
1182481463 22:30611855-30611877 TCTCATTCAAACCCCAAAACAGG - Intronic
949711250 3:6873557-6873579 CCTCATTTAACACTGAAAACAGG - Intronic
949882544 3:8673371-8673393 GCTCGTTTACGATGCAAAACGGG + Intronic
950175175 3:10868420-10868442 GCTCATTTACATCCCAATACTGG - Intronic
957044895 3:75365892-75365914 GCTCGTTTATGACCCAAAACAGG - Intergenic
957076688 3:75608088-75608110 GCTCGTTTATGACCCAAAACGGG - Intergenic
957981317 3:87515245-87515267 GATAATTTAACAACCAAAACAGG + Intergenic
961068992 3:123903572-123903594 GTTCATAGAAGACCCCAAACTGG + Intronic
961204645 3:125072217-125072239 TCTCATTTTTGACCCAAAAAAGG + Intergenic
961271775 3:125694876-125694898 GCTCGTTTACGACCCAAAACGGG + Intergenic
961274608 3:125717101-125717123 GCTCGTTTACGACCCAAAACGGG + Intergenic
961277530 3:125739733-125739755 GCTCGTTTATGACCCTAAACGGG + Intergenic
961876893 3:130029931-130029953 GCTCGTTTACGACCCAAAACGGG - Intergenic
961893325 3:130148105-130148127 GCTCATTTAAGACCCAAAACGGG - Intergenic
963224069 3:142842987-142843009 GCTCTTTTAAAACCCCCAACTGG - Exonic
963647226 3:147930064-147930086 GTTCTTTTAAGACATAAAACTGG - Intergenic
963807453 3:149738873-149738895 GCACATTTAAGACAGTAAACGGG - Exonic
964036444 3:152205058-152205080 ACTCATTTAAGACAAAAAATGGG - Intergenic
964522879 3:157586412-157586434 GCTCACTTATGGCCCAAGACTGG - Intronic
965124925 3:164614044-164614066 GTTCAATTAAGACCCACAAAAGG - Intergenic
968989170 4:3897132-3897154 GCTCGTTTGCGACACAAAACGGG - Intergenic
969020142 4:4134382-4134404 GCTCGTTTATGACCCAAAACGGG - Intergenic
969024842 4:4164776-4164798 GCTCGTTTGAGACGCAAAACGGG - Intergenic
969025741 4:4170721-4170743 GCTCGTTTACGACCCAAAACGGG - Intergenic
969728973 4:8942387-8942409 GCTCGTTTACGACCCAAAACGGG + Intergenic
969733715 4:8973030-8973052 GCTCGTTTACGACCCAAAACGGG + Intergenic
969785147 4:9451921-9451943 GCTCGTTTACGACCCAAAACGGG + Intergenic
969793305 4:9507090-9507112 GCTCGTTTACGACCCAAAACGGG + Intergenic
969826191 4:9760465-9760487 GCTCGTTTACGACCCAAAACGGG + Intergenic
970470776 4:16377268-16377290 GCTCATTTGAGAACAGAAACTGG + Intergenic
971092237 4:23359658-23359680 GCACATTTCAGATCCTAAACAGG - Intergenic
973740256 4:53912594-53912616 AATCATTTCAGACCCAAACCAGG + Intronic
975226711 4:71880997-71881019 TCTCATTTAGGAACCAAAAGGGG + Intergenic
976660546 4:87535918-87535940 TCTTATTTAGGAACCAAAACGGG - Intergenic
976879589 4:89903486-89903508 GGTCATTAAAGAAGCAAAACAGG + Intronic
976970477 4:91096191-91096213 GCCCATTTACGGCCCAATACTGG - Intronic
978526177 4:109668738-109668760 GCTCAATTAAAAACCAAAAAAGG - Intronic
980526442 4:133995395-133995417 GCTCATGTAAGTCCCCAGACTGG + Intergenic
981604510 4:146527477-146527499 GCTCGTCTACGACCCAAAACTGG + Intergenic
985854650 5:2415667-2415689 GCTCAGTGAAAACCCAAAAGAGG - Intergenic
985887671 5:2692622-2692644 TCTCATTTAGGAACCAAAATGGG - Intergenic
986002762 5:3643130-3643152 CCTCATTTCAGCCCCATAACAGG - Intergenic
987157862 5:15109167-15109189 TCTCATTTAGGAACCAAAAGGGG - Intergenic
990136976 5:52657517-52657539 TCTTATTTAATACTCAAAACAGG + Intergenic
990590177 5:57254348-57254370 CCACATTTAAGAAGCAAAACAGG - Intronic
991549916 5:67824691-67824713 GGCCACTTAAGACCCTAAACTGG - Intergenic
991568984 5:68034776-68034798 GGTCATTTAAGCCCCCAGACAGG - Intergenic
998886414 5:146699368-146699390 GCTCATTTTAATCCCAAGACTGG + Intronic
999628121 5:153541629-153541651 CCTCATTTAAGACCAAGAAAAGG + Intronic
1003305429 6:4922780-4922802 GCACATTCGAGGCCCAAAACAGG - Intronic
1005064010 6:21800837-21800859 ACTCATTTAAAACCAAAATCAGG - Intergenic
1008127599 6:47686321-47686343 CCCCATATAAAACCCAAAACAGG - Intronic
1009813393 6:68699608-68699630 TCCCATTTGAGACCCAAATCAGG + Intronic
1017060577 6:150481181-150481203 AATCATTTAAGAGCCAAAGCAGG + Intergenic
1018871489 6:167787052-167787074 GCTCAATTAAGAGACAAAACAGG - Intronic
1020307555 7:6846417-6846439 GCTCTTTTACGACCCAAAACGGG - Intergenic
1020312013 7:6875236-6875258 GCTCGTTTGCGACGCAAAACGGG - Intergenic
1020323552 7:6957602-6957624 GCTCGTTTAAGACTCAAAACGGG - Intergenic
1022055943 7:26734544-26734566 GCTGCTATAATACCCAAAACTGG + Intronic
1022170701 7:27826629-27826651 GCTCATTTAACACTGAAACCAGG - Intronic
1024011365 7:45269876-45269898 GCTTAGTTAGGTCCCAAAACTGG + Intergenic
1024132176 7:46364328-46364350 CCTCATTCAAGACTCAAAAGTGG - Intergenic
1024594391 7:50919691-50919713 CATCATCTAAGAACCAAAACGGG - Intergenic
1026153047 7:67804093-67804115 GCTCATGTCAGGCACAAAACAGG - Intergenic
1028325003 7:89512658-89512680 GCTCATAGAATACCCAAAATTGG + Intergenic
1029078673 7:97955356-97955378 ACCCGTTTACGACCCAAAACAGG - Intergenic
1035927434 8:3743629-3743651 CCTCATTTAGGAACCAAAAAGGG - Intronic
1036239343 8:7069130-7069152 GCTCATTTACAACCCAAAACCGG + Intergenic
1036262542 8:7251995-7252017 GCTCGTTTACGACCCAAAACGGG - Intergenic
1036304045 8:7587563-7587585 GCTCGTTTACGACCCAAAACGGG + Intergenic
1036314581 8:7710534-7710556 GCTCGTTTACGACCCAAAACGGG - Intergenic
1036354900 8:8035555-8035577 GCTCGTTTACGACCCAAAACGGG + Intergenic
1036372511 8:8173381-8173403 GCTCGTTTAAGACCCAAAACGGG + Intergenic
1036817112 8:11910484-11910506 GCTCGTTTAAGACCCAAAATGGG - Intergenic
1036817449 8:11912795-11912817 GCTCGTTTATGGCCCAAAATGGG - Intergenic
1036820414 8:11935375-11935397 GCTCGTTTAAGACCCAAAATGGG - Intergenic
1036833840 8:12041990-12042012 GCTCGTTTACGACCCAAAAAGGG - Intergenic
1036855685 8:12288555-12288577 GCTCGTTTACGACCCAAAAAGGG - Intergenic
1036878392 8:12492260-12492282 GCTCGTTTAAGACCCAAAACGGG - Intergenic
1036904010 8:12692398-12692420 GCTCGTTTATGACCCTAAACCGG - Intergenic
1038798623 8:30730185-30730207 GCTCGTTTAAGACCCAAAACGGG + Intergenic
1042496430 8:69459158-69459180 TCTCATTTCAGAGCAAAAACGGG + Intergenic
1042580393 8:70271097-70271119 GCTCATTAAAAACGCAACACAGG + Intronic
1042676075 8:71323912-71323934 GCTCCTCTAAGACAGAAAACAGG + Intronic
1044426116 8:92052567-92052589 GCTTATTTATGACCAAAAAGGGG + Intronic
1046713436 8:117540476-117540498 GATCATTTAAGACCAAACACTGG - Intergenic
1055474695 9:76650685-76650707 TTGCATTTAAGACCTAAAACAGG + Intronic
1055500772 9:76900492-76900514 GCTAATTTGAGACCCCTAACAGG + Intronic
1056806801 9:89735462-89735484 GCTCCTTACAGACCAAAAACAGG + Intergenic
1056865328 9:90223658-90223680 GCTCGTTTACGACCCAAAACGGG + Intergenic
1056917682 9:90759229-90759251 GCTCGTTTACGACCCAAAACGGG - Intergenic
1058878479 9:109265517-109265539 ACTCTTTTAAAACACAAAACAGG + Intronic
1059845032 9:118265851-118265873 GCTCATTTAACAGCCTAAAAAGG - Intergenic
1060579283 9:124729757-124729779 GCTCATTTGAACCCCAAAACTGG + Intronic
1062224668 9:135442994-135443016 GCTCGTTTAAGACCCAAAACTGG - Intergenic
1185909487 X:3968987-3969009 GCTCACTTACGGCCCAAGACTGG + Intergenic
1185978513 X:4749019-4749041 TCTTATTTAAGAACCAAAAGGGG + Intergenic
1190165406 X:48069473-48069495 GCTCATGTAATACCAAAATCTGG - Intronic
1190315401 X:49147388-49147410 GCCCATTTGAGGCCTAAAACTGG - Intergenic
1193277436 X:79605404-79605426 GCTCCTTTAAGACCTAGAAGTGG + Intergenic
1194400049 X:93431283-93431305 GCTGGTTTAAGACCCAAAACGGG + Intergenic
1200947870 Y:8864356-8864378 GCTCGTTTAAGACCCAAAACTGG + Intergenic
1201794148 Y:17876474-17876496 TCCCATTTAAGACCAAAAAAAGG - Intergenic
1201807406 Y:18029511-18029533 TCCCATTTAAGACCAAAAAAAGG + Intergenic
1202355530 Y:24044287-24044309 TCCCATTTAAGACCAAAAAAAGG - Intergenic
1202515248 Y:25625822-25625844 TCCCATTTAAGACCAAAAAAAGG + Intergenic