ID: 1171408547

View in Genome Browser
Species Human (GRCh38)
Location 20:24930246-24930268
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171408541_1171408547 8 Left 1171408541 20:24930215-24930237 CCTTCAAGTGCATGGAGCGTTAT No data
Right 1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG No data
1171408538_1171408547 18 Left 1171408538 20:24930205-24930227 CCTTTTTAACCCTTCAAGTGCAT No data
Right 1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG No data
1171408540_1171408547 9 Left 1171408540 20:24930214-24930236 CCCTTCAAGTGCATGGAGCGTTA No data
Right 1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171408547 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intergenic