ID: 1171408918

View in Genome Browser
Species Human (GRCh38)
Location 20:24933303-24933325
Sequence CCTCCACCAAGGGCACCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171408918_1171408926 -8 Left 1171408918 20:24933303-24933325 CCCCCTGGTGCCCTTGGTGGAGG No data
Right 1171408926 20:24933318-24933340 GGTGGAGGCTGTAGTTTTGGAGG No data
1171408918_1171408930 29 Left 1171408918 20:24933303-24933325 CCCCCTGGTGCCCTTGGTGGAGG No data
Right 1171408930 20:24933355-24933377 AGGTCCCTGCCCTTCTCACAGGG No data
1171408918_1171408927 9 Left 1171408918 20:24933303-24933325 CCCCCTGGTGCCCTTGGTGGAGG No data
Right 1171408927 20:24933335-24933357 TGGAGGCCACAAGTCAACTCAGG No data
1171408918_1171408929 28 Left 1171408918 20:24933303-24933325 CCCCCTGGTGCCCTTGGTGGAGG No data
Right 1171408929 20:24933354-24933376 CAGGTCCCTGCCCTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171408918 Original CRISPR CCTCCACCAAGGGCACCAGG GGG (reversed) Intergenic
No off target data available for this crispr