ID: 1171409822

View in Genome Browser
Species Human (GRCh38)
Location 20:24938657-24938679
Sequence AGTCTTCTGAGGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171409816_1171409822 16 Left 1171409816 20:24938618-24938640 CCCAGTGGCAGGCCAAGAGCTGC No data
Right 1171409822 20:24938657-24938679 AGTCTTCTGAGGAAGATGGCAGG No data
1171409817_1171409822 15 Left 1171409817 20:24938619-24938641 CCAGTGGCAGGCCAAGAGCTGCT No data
Right 1171409822 20:24938657-24938679 AGTCTTCTGAGGAAGATGGCAGG No data
1171409818_1171409822 4 Left 1171409818 20:24938630-24938652 CCAAGAGCTGCTCCTCAAAGTGA No data
Right 1171409822 20:24938657-24938679 AGTCTTCTGAGGAAGATGGCAGG No data
1171409819_1171409822 -8 Left 1171409819 20:24938642-24938664 CCTCAAAGTGAGAGCAGTCTTCT No data
Right 1171409822 20:24938657-24938679 AGTCTTCTGAGGAAGATGGCAGG No data
1171409814_1171409822 28 Left 1171409814 20:24938606-24938628 CCTGTACTAAGGCCCAGTGGCAG No data
Right 1171409822 20:24938657-24938679 AGTCTTCTGAGGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171409822 Original CRISPR AGTCTTCTGAGGAAGATGGC AGG Intergenic
No off target data available for this crispr