ID: 1171411938

View in Genome Browser
Species Human (GRCh38)
Location 20:24953388-24953410
Sequence GATGATCCTGTTCCTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171411938 Original CRISPR GATGATCCTGTTCCTCCGTG GGG Intronic
900246174 1:1637164-1637186 GATGATCCAGCTGCTGCGTGGGG - Exonic
903215161 1:21839635-21839657 GGTGATCCTGTCCCTCTATGGGG + Intronic
906019534 1:42615215-42615237 GCTGATGCTGTTCCTCTCTGGGG + Intronic
906395015 1:45455310-45455332 GCAGATCCCGTTCCTCTGTGGGG - Intronic
908615354 1:65914749-65914771 AATAATCCTGATCCTCCCTGAGG + Intronic
909034924 1:70586171-70586193 GCTGATTCAGTTCCTCTGTGGGG - Intergenic
912508852 1:110174885-110174907 GATGACCCTGTGCCTCCTCGTGG + Exonic
914332662 1:146686824-146686846 CATGATCTTGTTCGTCCATGTGG + Intergenic
915054860 1:153118411-153118433 GATTATAATGTGCCTCCGTGTGG - Intergenic
920262295 1:204697137-204697159 GATGAGTCTGTTCCTCGGTGGGG + Intergenic
922013893 1:221623076-221623098 GCTGATTCTGTTCCTCTCTGGGG + Intergenic
923295947 1:232595052-232595074 GCTGTTCCTGTTCCTCCGAATGG - Intergenic
924319144 1:242829732-242829754 GATGCTCCTGTGCCTCCCTAGGG - Intergenic
1065156099 10:22871690-22871712 GTTGATTCCGTTCCTCTGTGGGG - Intergenic
1065735243 10:28745498-28745520 GCTGACCCTGTTCCTCTGTGGGG + Intergenic
1066271468 10:33828383-33828405 GCTGATCCCATTCCTCTGTGGGG + Intergenic
1066460411 10:35608101-35608123 GCTGATGCTGTTCCTCTGGGCGG + Exonic
1069250608 10:66261804-66261826 GTTGATTCTGTTCCTCTGTGGGG - Intronic
1069685484 10:70315663-70315685 GCTGACCCTGATCCTCTGTGGGG - Intronic
1070829462 10:79409690-79409712 GCTGTTCCTGGTCCTCAGTGTGG + Intronic
1071535300 10:86423945-86423967 GTTGATTCTATTCCTCTGTGGGG - Intergenic
1078190396 11:9089344-9089366 GCTGATCCTGCACCTCCCTGGGG - Intronic
1078253038 11:9633880-9633902 GCTGATTCTTTTCCTCCCTGTGG + Intergenic
1085540409 11:77262639-77262661 GCTGATTCTGTTCCTCTGTGGGG - Intronic
1098909755 12:76196813-76196835 GCTGATCCCATTCCTCTGTGGGG + Intergenic
1102968335 12:117146493-117146515 GAAGATCCTGCTGTTCCGTGGGG - Intronic
1105840521 13:24249809-24249831 GATTGTCCAGTTCCTCCGTCTGG - Exonic
1106890610 13:34241745-34241767 GATGTTTCTGTTCCCCAGTGAGG - Intergenic
1107330150 13:39290984-39291006 GCTGATTCTATTCCTCTGTGGGG - Intergenic
1108253523 13:48589582-48589604 GCTCATCCTGTTTCTCTGTGGGG + Intergenic
1114510227 14:23252719-23252741 GCTGATTCAGTTCCTCTGTGGGG + Intronic
1114979713 14:28147669-28147691 GATGATCCTGGTCTTGAGTGTGG + Intergenic
1117067498 14:52025164-52025186 AATGATGCTTTTCCTTCGTGTGG - Intronic
1118354642 14:65002849-65002871 GCAGATCCTGTTCCTTTGTGGGG + Intronic
1122400238 14:101462796-101462818 TTTGATCCTGTGCCTCCCTGGGG + Intergenic
1129338715 15:74871103-74871125 GATGATCTTTTTCCACCATGAGG - Intronic
1131439494 15:92448272-92448294 AATGATCCTCTCCCTCCGTGGGG + Intronic
1133117097 16:3583510-3583532 GATCCACCTGTTCCTCCGTCAGG - Exonic
1133521710 16:6564708-6564730 GAGGATCTTGTTCCCCAGTGTGG + Intronic
1134165470 16:11926088-11926110 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1134489837 16:14688359-14688381 GAGGATGCTGTGCCTCCCTGGGG - Intronic
1134495217 16:14727476-14727498 GAGGATGCTGTGCCTCCCTGGGG - Intronic
1134500603 16:14766596-14766618 GAGGATGCTGTGCCTCCCTGGGG - Intronic
1134527142 16:14953209-14953231 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1134545259 16:15103139-15103161 GAGGATGCTGTGCCTCCCTGGGG + Intronic
1134579980 16:15362454-15362476 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1134714728 16:16351742-16351764 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1134722605 16:16395106-16395128 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1134855422 16:17514661-17514683 GCTGATCCCTTTCCTCTGTGGGG + Intergenic
1134944823 16:18316765-18316787 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1134952087 16:18356916-18356938 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1135310431 16:21400978-21401000 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1135363375 16:21833406-21833428 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1135448416 16:22537672-22537694 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1135802025 16:25506440-25506462 GAAGATCCTGTCCTGCCGTGAGG + Intergenic
1136150010 16:28341327-28341349 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1136166245 16:28455142-28455164 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1136196727 16:28659890-28659912 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1136213067 16:28774015-28774037 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1136257794 16:29053928-29053950 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1136307174 16:29380132-29380154 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1136320699 16:29482375-29482397 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1136435272 16:30221715-30221737 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1137453306 16:48597584-48597606 GCTGATTCTGTTCCTCTCTGGGG - Intronic
1139855302 16:69975128-69975150 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1139885019 16:70202243-70202265 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1140000952 16:71024417-71024439 CATGATCTTGTTCGTCCATGTGG - Intronic
1140194427 16:72845059-72845081 CAGGTTCCTGCTCCTCCGTGTGG + Intronic
1140367496 16:74393270-74393292 GAGGATGCTGTGCCTCCCTGGGG - Intergenic
1145036593 17:19545117-19545139 GCTGATTCAGTTCCTCCTTGTGG + Intronic
1149447212 17:56722721-56722743 GATCAGCTTGTTCCTACGTGGGG - Intergenic
1153124703 18:1776903-1776925 GCTGATGCTGTTCCTCTGTGAGG + Intergenic
1153157232 18:2163392-2163414 GCTGATCCTGTTCCTTCGTGGGG + Intergenic
1153444012 18:5152331-5152353 ACCGATCCTGTTCCTCTGTGTGG - Intronic
1153833728 18:8945686-8945708 GCTGATTCCATTCCTCCGTGGGG - Intergenic
1154116727 18:11618097-11618119 GAGGATGCTGTGCCTCCCTGGGG + Intergenic
1156815862 18:41310303-41310325 GCTGATCCTCTTCCTCTGTGAGG + Intergenic
1157258366 18:46157935-46157957 GGGGATCCCGTTCCTCTGTGGGG + Intergenic
1158859873 18:61581822-61581844 GATCTTCCTGTTTCTCCCTGGGG - Intergenic
1160307479 18:77753635-77753657 GAGGCTCCTCTTCCTCTGTGAGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1162880644 19:13656359-13656381 GCTGATCCTATTCCTCTGTGGGG + Intergenic
1164390557 19:27816165-27816187 CATGATCCTGTTCCTTTTTGTGG + Intergenic
1164684920 19:30160303-30160325 GCTGATCCCCATCCTCCGTGGGG - Intergenic
925609752 2:5693003-5693025 GAAGATCCCGTTCATCCGGGAGG + Exonic
927146743 2:20171142-20171164 GATGCACCTGTTCCTCCTTCGGG - Intergenic
928364901 2:30692867-30692889 GATGACCCTGATTATCCGTGTGG + Intergenic
931448758 2:62349946-62349968 GCTGATTCAGTTCCTCCGTGGGG - Intergenic
933139502 2:78776636-78776658 GCTGATTCGGTTCCTCTGTGGGG + Intergenic
935210244 2:100933548-100933570 GATGCTCATGTTCCTCCCTCTGG + Intronic
935256154 2:101311396-101311418 GATGATTCTGTTCCTCTGTGGGG + Intergenic
937003909 2:118493753-118493775 GCTGATCACGTTCCTCTGTGGGG + Intergenic
937953854 2:127408318-127408340 GAGGCTCCTGGCCCTCCGTGGGG + Intergenic
938910650 2:135882643-135882665 CATGAGCCTGTTACTCAGTGGGG - Intergenic
939829868 2:147058755-147058777 GCTGATCCTGTTCCTCTGTGAGG + Intergenic
941684801 2:168437578-168437600 TAAGATCCTGTTCCTGCTTGAGG + Intergenic
948612702 2:239179882-239179904 GATGTGCAGGTTCCTCCGTGCGG - Intronic
949070304 2:242020489-242020511 GATGTGGCTGTTCCTCTGTGAGG + Intergenic
1171030610 20:21673167-21673189 AATGATCCTGTTCTTCCTGGAGG - Intergenic
1171411938 20:24953388-24953410 GATGATCCTGTTCCTCCGTGGGG + Intronic
1173915438 20:46704826-46704848 GCTGATTCAGTTCCTCTGTGGGG + Intergenic
1175686383 20:61031449-61031471 GAGGACCCTGATCCTCTGTGGGG - Intergenic
1177782445 21:25635470-25635492 GATGAGCCAGTTTCTCCGTCGGG - Intergenic
1180256996 21:46636199-46636221 CATGATCCTGTTCCTCCCGAGGG + Exonic
1184599386 22:45533494-45533516 GAAGATGCTGCCCCTCCGTGGGG + Intronic
950560228 3:13717030-13717052 CAGGATCCTGATCCTCTGTGAGG + Intergenic
950749075 3:15114615-15114637 GCTGATCCCGTTCCTCTGTGGGG - Intergenic
951691123 3:25397307-25397329 GATTTTCAGGTTCCTCCGTGAGG + Intronic
952647512 3:35679441-35679463 GGTGATCCTGATCCTCATTGAGG + Intronic
954160128 3:48715328-48715350 GATGAGCCTGAACCTCCCTGAGG - Intronic
954448849 3:50560997-50561019 ACTCATCTTGTTCCTCCGTGGGG + Exonic
959053741 3:101549348-101549370 GTTGATTCAGTTCCTCTGTGGGG + Intergenic
961705266 3:128780046-128780068 GCTGATCATGTTCCTCCATGGGG + Intronic
983888693 4:173008727-173008749 GTTGATCCATTTCCTCTGTGAGG + Intronic
1000387869 5:160692675-160692697 GCTGATTCTGTTCCTATGTGGGG - Intronic
1001441118 5:171743717-171743739 GCTAATCCTATTCCTCCTTGGGG + Intergenic
1001616649 5:173048259-173048281 GCTGATCCCGTTCCTCTGTGGGG + Intergenic
1003240893 6:4344754-4344776 CATCTTCCTCTTCCTCCGTGGGG + Intergenic
1004378910 6:15115449-15115471 GCTGATCCCATTCCTCTGTGGGG - Intergenic
1004609369 6:17224783-17224805 GCTGATCCCATTCCTCTGTGGGG + Intergenic
1007009506 6:38401535-38401557 AATGATTCTGTTCCTCCTTTGGG - Intronic
1011229248 6:85141491-85141513 GCTGATTCTGTTCTTCTGTGTGG - Intergenic
1012443128 6:99280821-99280843 GATGATCCTCTTCAACCCTGAGG - Exonic
1012480801 6:99664775-99664797 GCTGATTCAGTTCCTCTGTGGGG + Intergenic
1018862216 6:167719425-167719447 TAGGTTCTTGTTCCTCCGTGAGG - Intergenic
1021340601 7:19458481-19458503 GATGCTCCTGTACCCCTGTGGGG - Intergenic
1022387752 7:29917463-29917485 GATGATTCTGTTCCTACAGGAGG - Intergenic
1026221997 7:68406730-68406752 GCTGATCCATTTCCTCCATGGGG - Intergenic
1026493657 7:70884540-70884562 GCAGATTCTGTTCCTCTGTGGGG + Intergenic
1026562642 7:71463164-71463186 GCTGATCCCATTCCTCTGTGAGG + Intronic
1029589300 7:101496537-101496559 GCTCATCCTCTTCCTCTGTGGGG + Intronic
1032357029 7:131220674-131220696 GCTGATCCTCTTCCTCTGTGGGG + Intronic
1044654249 8:94530962-94530984 GATGATCCTGTGCCTCTGCCAGG - Exonic
1045295229 8:100866701-100866723 GCTGATCCTGTTCCTCTGTTGGG + Intergenic
1046072354 8:109272539-109272561 TGTGATCCTGTTACTCTGTGAGG - Intronic
1046124005 8:109881701-109881723 GTTGATTCTGTTCCTCTGTGGGG + Intergenic
1059136903 9:111815838-111815860 GCTGATCCCGTTCTTCTGTGGGG + Intergenic
1061887118 9:133596712-133596734 GAGGAGCCTGCTGCTCCGTGGGG + Intergenic
1186047759 X:5554391-5554413 GATGATTGTGTTCCTCTGTGGGG - Intergenic
1188967743 X:36575923-36575945 GCTGATCCGGTTCCTCTGCGGGG + Intergenic
1189368057 X:40404599-40404621 GCTGATCTTGTTCCTCTGTGGGG - Intergenic
1189420365 X:40851779-40851801 GCTGATTCGGTTCCTCTGTGGGG + Intergenic
1191913201 X:66173630-66173652 GATGACTCTGTTCCCCCGGGGGG + Exonic
1195477081 X:105299519-105299541 GCTAATCTTGTTCCTCTGTGGGG + Intronic
1201780877 Y:17721469-17721491 GATGAGCCTGTTCCGCTTTGTGG - Intergenic
1201820676 Y:18184521-18184543 GATGAGCCTGTTCCGCTTTGTGG + Intergenic