ID: 1171416215

View in Genome Browser
Species Human (GRCh38)
Location 20:24982411-24982433
Sequence GTAGAAAAGCCTGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171416215_1171416217 26 Left 1171416215 20:24982411-24982433 CCTTCCTCATCAGGCTTTTCTAC 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1171416217 20:24982460-24982482 AACAACTTCCAATCCCCAGTAGG 0: 1
1: 0
2: 0
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171416215 Original CRISPR GTAGAAAAGCCTGATGAGGA AGG (reversed) Intronic
900841406 1:5051463-5051485 GGAGGAAAGTCTGATGAGCAAGG - Intergenic
901481509 1:9528406-9528428 GAAGGAAAGCCAGATGTGGAAGG - Intergenic
901848749 1:12001628-12001650 GTAGAAAATCCTTCTGAGAAGGG + Intronic
902091850 1:13909957-13909979 GTGGAGAAGGCTGATTAGGAAGG + Intergenic
904913175 1:33950562-33950584 GTAGGAGAGCCTGTTGAGGATGG + Intronic
905842322 1:41192594-41192616 GTAGCAAAGGATGATGATGAAGG - Intronic
908124911 1:61021087-61021109 GCAGAAGAGCCTGATGGGTATGG + Intronic
908171100 1:61505422-61505444 GTATAAAAGTCTTAGGAGGAAGG - Intergenic
908663766 1:66466473-66466495 GTAGAAAGGCATGAGGAGGGAGG - Intergenic
909411011 1:75351424-75351446 ATAGAAAAGCCTGAAGTGAAAGG + Intronic
909666798 1:78143226-78143248 CTAAAGAAGCCTGAAGAGGAGGG - Intergenic
909900812 1:81132417-81132439 GAAGAAAAGCCTGATGTTCAGGG - Intergenic
910197454 1:84658317-84658339 GTAGAAAAGCTTGATAACCAAGG - Exonic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
912244846 1:107950641-107950663 GCAGCAAAGCCTGAGAAGGAGGG + Intronic
912519441 1:110235144-110235166 GTAGAACAGCAGGGTGAGGACGG + Intronic
912604245 1:110972139-110972161 GTTGAAACGCCTTATGTGGATGG - Intergenic
912727713 1:112074358-112074380 CTAGGAAAGCCTACTGAGGAAGG + Intergenic
915788052 1:158637387-158637409 GAAGAGAAGCGTGATGAGGCAGG + Intronic
916122700 1:161542920-161542942 GTAGAGAGGCCTGAGGATGATGG + Exonic
916132596 1:161624360-161624382 GTAGAGAGGCCTGAGGATGATGG + Exonic
916517917 1:165537355-165537377 GAAGAAAACCTTTATGAGGAAGG + Intergenic
917917937 1:179722993-179723015 GGAGAAAAACCAGATGAGTATGG + Intergenic
918484979 1:185019150-185019172 GGACAAAAGCCTGATTAGAATGG - Intergenic
920051543 1:203167582-203167604 GTAGCAAACCCTGATCAGAAAGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921252446 1:213310533-213310555 GTAGAAAAGGGTGATGGGGTAGG - Intergenic
921840812 1:219826448-219826470 GAAAGAAAGCCTGATGAGGGAGG - Intronic
923069020 1:230545880-230545902 CTAGAAAAGGTTGAGGAGGAGGG + Intergenic
923252046 1:232186430-232186452 TTAGACAAGCCTGGTGAAGAGGG - Intergenic
923692172 1:236205269-236205291 TTAGACAAGCCTCATCAGGAGGG + Intronic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
924956178 1:248929664-248929686 GTGGAAAAGACTAATGATGATGG - Intergenic
1063155476 10:3375447-3375469 GCAGCAGAGCCTGATCAGGAGGG + Intergenic
1063194719 10:3730453-3730475 CCAGCACAGCCTGATGAGGATGG - Intergenic
1063288001 10:4711629-4711651 ATAGAACAGCTTGCTGAGGAGGG + Intergenic
1064330072 10:14385383-14385405 GGAGAAAACCCTGATGCAGAAGG + Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1066638960 10:37536467-37536489 GCAGAAAAGACGGATGAGGAAGG + Intergenic
1066716248 10:38289529-38289551 GCAGAAAAGTGGGATGAGGAAGG + Intergenic
1067343238 10:45420723-45420745 GGAGCAAAGCCTGCTGAGGAGGG - Intronic
1067483056 10:46618042-46618064 GTAGAAAAGGCTGAGAAAGAAGG + Intergenic
1067611699 10:47723602-47723624 GTAGAAAAGGCTGAGAAAGAAGG - Intergenic
1068514971 10:58014099-58014121 TTAGAAAAGCCTGGTAAGGAAGG + Intergenic
1068605888 10:59004412-59004434 GGAGAAGAGCCTGGTGATGAAGG + Intergenic
1069093949 10:64235727-64235749 ATAGAAAAGAGTGATGAAGAAGG + Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1071070422 10:81685270-81685292 GTACAAAAGACTGAAGAGGCTGG + Intergenic
1071562118 10:86652713-86652735 GTGGAAGAGCCTCAGGAGGAAGG + Intergenic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1074755705 10:116622408-116622430 GCAGAAAAGCCTGAGAAGGCTGG - Intronic
1076383292 10:130039479-130039501 GTAGAACAGGAAGATGAGGAGGG - Intergenic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1077698613 11:4418697-4418719 ATATGAAAGCATGATGAGGAAGG - Intergenic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078643395 11:13116340-13116362 TTAGGAAAGACTGATGAGAAGGG - Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080332260 11:31153229-31153251 GGAGAAGAGGCAGATGAGGAGGG - Intronic
1081664212 11:44907022-44907044 TTCAAAAAGCCTGTTGAGGAAGG - Intronic
1083320264 11:61841662-61841684 GCATAAATGCCAGATGAGGAAGG - Intronic
1084635491 11:70389647-70389669 GTAGAAAAGAGGGATAAGGAAGG - Intergenic
1085170346 11:74444515-74444537 GGAGAAAAGACAGAAGAGGAAGG - Intergenic
1085355921 11:75836931-75836953 TTAGAAAAGCTTGATTAGAATGG - Intronic
1086460732 11:87003103-87003125 CTTGTAAAGCCTTATGAGGAAGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1089739865 11:120575081-120575103 GCTGAGAAGCCTGATGAGCAGGG - Intronic
1089972723 11:122707290-122707312 GTGGAAAAGCCTGCAGAGTAGGG - Intronic
1091222645 11:133938249-133938271 GTAGCAAAGCCTGAGGAGCTGGG - Intronic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1092017199 12:5169312-5169334 GAAGAACAGCCAGATGGGGAAGG - Intergenic
1092099318 12:5870149-5870171 GCAGAGAAGCCTGGGGAGGAAGG + Intronic
1093910473 12:24741682-24741704 GTGGAAAAGCCAGATGAGATGGG - Intergenic
1094745492 12:33340038-33340060 AAAAAAAAGCCTGATGAGGTTGG - Intergenic
1096524481 12:52202443-52202465 GGGGGAAAGCCTGGTGAGGACGG + Intergenic
1097989945 12:65824295-65824317 GAAGAAAAGTATGAGGAGGAGGG - Exonic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1100680892 12:96919381-96919403 TTAGAAAAGCCTGAGGGGCAAGG - Intronic
1101648624 12:106654358-106654380 GAGGACAAGCCTGATGAGGCTGG - Intronic
1102921310 12:116793637-116793659 GAACAAAAGCCTGAGAAGGAAGG - Intronic
1103959460 12:124599919-124599941 GCTGAGAAGCCTGATGAGGCAGG - Intergenic
1104466846 12:128997303-128997325 GTATGAAAGCCTGATAAGGAAGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1105032653 12:132894927-132894949 GGAGGAGAGCCTGATGAGCAAGG - Intronic
1105572182 13:21613030-21613052 GAAAATAAGCCTGATGAGAATGG - Intergenic
1105859493 13:24396203-24396225 CAAGAAAAGCCTGATGAAAATGG + Intergenic
1108274750 13:48796539-48796561 GGAGAAAAGACTGAAGGGGAAGG - Intergenic
1108364208 13:49693707-49693729 GTAGAAAGGACTGAGGAGCAGGG - Intergenic
1108514570 13:51188353-51188375 GAAGAACAGCCTGTTGAGAAAGG + Intergenic
1108921208 13:55676488-55676510 GCAGAAAATGCTGATGAGTATGG - Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110286861 13:73759820-73759842 GTAGAACAGTCTTTTGAGGAGGG - Intronic
1110577723 13:77079167-77079189 GTTGAAAGGCTTCATGAGGAAGG - Intronic
1114852004 14:26392868-26392890 GTATAAAAGCCTGATAAAGTAGG + Intergenic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1119009642 14:70971574-70971596 GTAGAGAAGCCACATGAGGGTGG - Intronic
1119122054 14:72088779-72088801 GCAGAAAGGCATGATGAGGAGGG - Intronic
1120316904 14:82905909-82905931 GTGGCAAAGGCAGATGAGGAAGG + Intergenic
1120969772 14:90197697-90197719 AGAGAACAGCCTGCTGAGGAGGG + Intergenic
1121589943 14:95096629-95096651 GGAGGAGAGCCTGATGTGGAGGG - Exonic
1122096698 14:99377647-99377669 GTAGAAAAGGCAGAGGAGGCCGG + Intergenic
1122097031 14:99379840-99379862 GTAGAAAAGGCAGAGGAGGCCGG - Intergenic
1124861425 15:33445613-33445635 GTAGAAAAATGGGATGAGGAGGG - Intronic
1126110306 15:45171254-45171276 GGAGGAAAGCCTGATGGGGAGGG + Intronic
1126179432 15:45770087-45770109 GTATAAAAGCCAGAGGAGGCTGG - Intergenic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1127151282 15:56078130-56078152 GAAGAAAAGTGGGATGAGGAGGG - Intergenic
1128203332 15:65828688-65828710 GTATGAAAGCCTGATGAGATGGG + Intronic
1128747073 15:70122270-70122292 TTAGAACAGCCTGGTGAGGTAGG + Intergenic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1131772326 15:95752072-95752094 ATAGAAAAGGCTGTTAAGGAAGG + Intergenic
1131993584 15:98113387-98113409 GTAAGAAACCCTAATGAGGAAGG - Intergenic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137404530 16:48179206-48179228 GCAGAAAAGTGAGATGAGGAAGG - Intronic
1139595856 16:67957907-67957929 GCAGATAAGCACGATGAGGAGGG + Exonic
1142215392 16:88827228-88827250 GGAGAAAAACCAGATGTGGAGGG + Intronic
1143313642 17:6014371-6014393 ATAGCAAAGCCTGAGGAGGGAGG + Intronic
1144041817 17:11418718-11418740 GTTGAAAAGGCTGATGTGAAAGG + Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1145861090 17:28211117-28211139 GTCAAAAAGTCTGATGAGGCTGG + Intergenic
1146539162 17:33679933-33679955 GTGTAATAGCCTGGTGAGGACGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1149581584 17:57754418-57754440 GGGGAAAGGCCTGAGGAGGAAGG - Intergenic
1149630647 17:58119466-58119488 GAATAAAAGCCCCATGAGGATGG - Intergenic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1151603673 17:75122856-75122878 GAAGCAAAGCCTGGTGAGGGGGG + Intronic
1152325581 17:79634050-79634072 GCAGATAAGCCCGGTGAGGAAGG - Intergenic
1154290469 18:13102076-13102098 GCAGCAAAGCCTCATGTGGAGGG - Intronic
1157416698 18:47509402-47509424 ATAGACAAGCCTGAGGAAGATGG - Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1158052142 18:53234982-53235004 TTTGAAAAACCTCATGAGGATGG + Intronic
1158713738 18:59859866-59859888 GGAGAAAAGCCACATGAGGAAGG + Intergenic
1158740732 18:60139334-60139356 GTAGAAAAGCCAGTTGAGGTTGG - Intergenic
1158927311 18:62281015-62281037 GTAGAAAAGAGGGAAGAGGAAGG - Intronic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162492070 19:10998816-10998838 GAAGAAAAGTCTGATGAGGAAGG - Intronic
1162991491 19:14305539-14305561 ATAGAAAAGCCAGAAGAGGTCGG - Intergenic
1166390757 19:42407627-42407649 GGAGATGAGCCTGACGAGGACGG + Exonic
1168243852 19:55100207-55100229 GAAGACAAGTGTGATGAGGAGGG - Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168663447 19:58184664-58184686 GTAGAAAAGACAGGTGAGGATGG + Intronic
925811699 2:7707747-7707769 TTAGAAAAGCATTATGATGAAGG - Intergenic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928592796 2:32834631-32834653 GGAGAAAAGACAGATGGGGAGGG - Intergenic
928756282 2:34529509-34529531 GTGGAAAAGGGTGATGGGGAAGG - Intergenic
929027623 2:37619928-37619950 GGAGAAAAGGCTGATTTGGAGGG + Intergenic
929226583 2:39517078-39517100 TTAGGAAAGCCTGGTGAGAAGGG - Intergenic
930456309 2:51611790-51611812 GTAGAAAACCCTGACTAGGCTGG - Intergenic
930550327 2:52826569-52826591 ATAGAGAAGGTTGATGAGGAGGG + Intergenic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
933058923 2:77710658-77710680 GAAGAAAAGCCTGATTTGAATGG - Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
935641845 2:105298298-105298320 GTATAAAAGCTTGATCACGATGG - Intronic
938489583 2:131754690-131754712 GCAGAAAGCCCTGAAGAGGAAGG + Intronic
939313843 2:140520487-140520509 GGAGAAATGCCTAATGTGGATGG + Intronic
940934742 2:159478676-159478698 GTAGAGGAGGCTGCTGAGGATGG + Exonic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
942604567 2:177676726-177676748 GTAGAAATGCCTGATACAGAAGG - Intronic
943385037 2:187192326-187192348 GTTGAAAAGCCAGTTGAGAAAGG + Intergenic
943412311 2:187559548-187559570 GGAGAAGAGTCTGATGAGCAAGG + Intronic
943947168 2:194081828-194081850 GTAGAAAATCCTAATGACAATGG - Intergenic
945300727 2:208213886-208213908 GTAGAAATGCCTGAGAAGTAGGG + Intergenic
947154611 2:227149421-227149443 GCAGAAAAGAGAGATGAGGAAGG - Intronic
1171416215 20:24982411-24982433 GTAGAAAAGCCTGATGAGGAAGG - Intronic
1172292080 20:33783944-33783966 GGAGAAGAGCCAGATGGGGATGG - Intronic
1172873683 20:38151331-38151353 CCAGAAGAGCCTTATGAGGAAGG + Intronic
1173175869 20:40764339-40764361 AAAGAAAAGCCTAATTAGGAAGG - Intergenic
1173641312 20:44604067-44604089 GCAGAAAAGCCAGTTGGGGAAGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173924802 20:46772844-46772866 GTAGAAAAGACTTCTGTGGATGG + Intergenic
1175689479 20:61055172-61055194 GAAGAAAAGGGTGAGGAGGATGG + Intergenic
1178948376 21:36966618-36966640 GTAGCACAGCGTGATGAGCATGG + Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1182809770 22:33105862-33105884 GCAGGAAAGCCTGATGACAAAGG + Intergenic
1183434000 22:37782934-37782956 CCAGAACAGCCTGATGAGGGAGG + Intergenic
1184265133 22:43342655-43342677 GGAGAAAAGACAGATGCGGAAGG - Intronic
1184397781 22:44254870-44254892 GAAGAAAAGCCTGTTGGGAAGGG - Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950856929 3:16114480-16114502 GTAGAGAAGCCTCATTAGAATGG - Intergenic
951846216 3:27087466-27087488 GTAAACAAGCCAGATGTGGAGGG + Intergenic
951986337 3:28625908-28625930 AGAGCAAAGCCTGATGAGGAAGG + Intergenic
952492900 3:33888748-33888770 GAAGAAAAGCTACATGAGGAAGG + Intergenic
952711410 3:36435882-36435904 GAAGGAAAGGCTGGTGAGGAAGG - Intronic
953540342 3:43812571-43812593 CTGGAAAAGCCTGATTAGGATGG + Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
964067737 3:152598657-152598679 GAAGAGCAGCCTGAGGAGGAGGG - Intergenic
964461937 3:156941793-156941815 GCAGAAAAGACTGATGAACAGGG + Intronic
965545804 3:169915279-169915301 GTAGAAAAGCAAGACCAGGAAGG - Intronic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968374216 4:24517-24539 GTGGAAAAGACTAATGATGATGG + Intergenic
969046534 4:4340523-4340545 GTATAAAAGCCTGGTTAGGCTGG + Intergenic
969114862 4:4865174-4865196 GAAGAAAAGCTTGCTGTGGAGGG + Intergenic
969845120 4:9914399-9914421 GAAGCAAAGTCTGATGAGAATGG - Intronic
971409677 4:26356984-26357006 GTAGCAGAGCCTGGTGGGGATGG + Intronic
971652322 4:29294158-29294180 GTCGAAAAGCCAGATTATGAAGG + Intergenic
972419100 4:38869429-38869451 GGAGAAAAGACTGGTGAGGCAGG + Intronic
973536525 4:51888292-51888314 GCAGAAAAGCCTGTCCAGGATGG + Intronic
974061670 4:57041443-57041465 GTTGAAAAGGGTGATGAGGCAGG + Intronic
974756779 4:66219575-66219597 GTAGAAAAGCCAGACAAGGCAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
977849662 4:101810420-101810442 GTATAAATGCCTGATGCGGAAGG - Intronic
978335172 4:107659472-107659494 GTAGTTAAGCATGATGAGAATGG - Intronic
979748674 4:124248483-124248505 GTGCAAATGCCTGATGAGAAGGG + Intergenic
981116443 4:140996120-140996142 ATAGCAAATACTGATGAGGATGG - Intronic
981123864 4:141083410-141083432 GTAGAAAAGGAAGAGGAGGAGGG - Intronic
981810562 4:148769491-148769513 GTAGAATAGCCTTGTGAGAAAGG - Intergenic
982547175 4:156748624-156748646 GAAGAAATGACTGATGAGTAGGG + Intergenic
984589925 4:181605948-181605970 GAAGAAAAGGATGATGTGGACGG - Intergenic
984968494 4:185164598-185164620 GCAGAAAAGAGAGATGAGGAAGG - Intronic
985460514 4:190101746-190101768 GTGGAAAAGACTAATGATGATGG - Intergenic
985676264 5:1232772-1232794 GTAGTACAGGCTGATCAGGAAGG - Exonic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991382492 5:66044873-66044895 TGAGAACAGCCTGATGAAGATGG + Intronic
993669091 5:90739403-90739425 CTAGAAAAGCCTGAAAAGGGTGG - Intronic
996500123 5:124207483-124207505 GGAGAAAAGACAGATGAGGTAGG + Intergenic
997189915 5:131922143-131922165 GTAGAAAAGTCTAGAGAGGAAGG - Intronic
997308768 5:132862025-132862047 GGAGAAGAGGCTGCTGAGGATGG - Exonic
999721481 5:154402069-154402091 GGAGAACAGCCTGATGGGGCAGG - Intronic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1001425349 5:171618865-171618887 GGAGCAGAGCCTGGTGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1004566988 6:16807378-16807400 GTTGCAAAGTCTCATGAGGAGGG + Intergenic
1006063728 6:31445304-31445326 GAACTAAAGGCTGATGAGGATGG + Intergenic
1008057744 6:46962728-46962750 GAAGAATATCCAGATGAGGAGGG - Intergenic
1008113603 6:47520654-47520676 TTATTATAGCCTGATGAGGATGG + Intronic
1008124159 6:47649799-47649821 GTAGAAAAGGCCCAGGAGGAGGG + Intergenic
1008805076 6:55417128-55417150 GCAGCAAAGCCAGCTGAGGAGGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009878839 6:69539870-69539892 GGAGAAAGGCCTGAAGAAGATGG - Intergenic
1013015468 6:106157057-106157079 CTATAAAATCCTGATTAGGAAGG + Intergenic
1013636756 6:112036446-112036468 GTAGCTAACCCTGCTGAGGAAGG - Intergenic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015004624 6:128264102-128264124 GAAGAAAAGCCAGAGGAAGATGG + Intronic
1015438013 6:133212861-133212883 TAAGAAGAGACTGATGAGGAAGG + Intergenic
1016618486 6:146080177-146080199 GTAGAAGAGGCTGGTGTGGAGGG + Intronic
1016723452 6:147329921-147329943 TTAAAAAAGCCTGAAGAGGCCGG - Intronic
1020948327 7:14643844-14643866 GTAGCAATTCCTGAGGAGGATGG - Intronic
1021431657 7:20566332-20566354 GGAGAAAAGCTTCATGAGGTTGG + Intergenic
1021506983 7:21396757-21396779 GCAGAAAAGCCTCAGGAGGCTGG - Intergenic
1021920686 7:25481951-25481973 GTGGCAAAGCCTGATGGGAAAGG + Intergenic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022598139 7:31731973-31731995 GGAGGAAATACTGATGAGGAGGG + Intergenic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023500993 7:40849411-40849433 GTAGAAATGCATCATTAGGATGG + Intronic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1027462397 7:78471260-78471282 GAAGAAAAGTCTGATGTGAATGG + Intronic
1030892789 7:115020915-115020937 GAATAAAAGCCTGTTGAGCAGGG + Intergenic
1031334465 7:120510772-120510794 GTAGAAAAAACTGATTAGGAAGG - Intronic
1032158147 7:129487309-129487331 GTAAAAAAGCTTGAAGAGGCTGG - Exonic
1032730865 7:134641665-134641687 GAAGAAAATCCTGGTCAGGAGGG + Intergenic
1033090911 7:138385241-138385263 TTAGAAAAGCCTGTTGATCAAGG + Intergenic
1033346236 7:140527357-140527379 GGAGAGCAGCCCGATGAGGAAGG + Exonic
1033591362 7:142811450-142811472 GAGGAAAAGGCTGATGTGGATGG - Intergenic
1033653909 7:143361320-143361342 GGAGAAGAGCCTGAGGAGAAGGG + Intronic
1033802362 7:144916167-144916189 CTAAAAAATCCTGATAAGGAAGG - Intergenic
1034492738 7:151402657-151402679 GTAGAGATGACTGATGAGGCCGG + Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1039203003 8:35117599-35117621 TTAGAAAAGAATGATGAGGCTGG + Intergenic
1039237103 8:35513533-35513555 TTAGAATAGCTTGTTGAGGAAGG - Intronic
1040722545 8:50343981-50344003 AGAGAAAAGCCAGCTGAGGATGG - Intronic
1041300255 8:56404127-56404149 GAAGAAAAGCCTGGTCAAGATGG + Intergenic
1041647416 8:60267577-60267599 GCAGAAAAGCGGGATGAAGAGGG + Intronic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043543367 8:81288164-81288186 GTAGAAAGGGCTGATGAAGCCGG + Intergenic
1044481765 8:92698874-92698896 GTAGAAAAAACTGATGATGCAGG + Intergenic
1045288907 8:100815062-100815084 TTAGAAAGGCCAGATGAGGCCGG - Intergenic
1045320014 8:101075308-101075330 TCAGAAAAGCCTGGTAAGGAAGG - Intergenic
1045375016 8:101563390-101563412 GTACAAAAGGTTGATGAGCAGGG + Intronic
1046037545 8:108862225-108862247 GTAGAAGTGCCTGAGGAGGAGGG - Intergenic
1048262796 8:132959920-132959942 GCAGAAAAGAGTGATGAGGAAGG + Intronic
1049127695 8:140807008-140807030 GAAGGAAAGCCCCATGAGGATGG + Intronic
1049745198 8:144260346-144260368 GAAGAAAGGCCGGATGCGGATGG - Exonic
1050524673 9:6535119-6535141 GTATAAAAGCATGATGAGAATGG - Intronic
1050858353 9:10391407-10391429 GAAGAATAGCCTGTTGAGCATGG + Intronic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG + Exonic
1057861658 9:98645523-98645545 GGAGAAAATCCTGATGAGAGTGG - Intronic
1058384430 9:104417271-104417293 GGAGACAAGCATGATGAAGAGGG - Intergenic
1058746359 9:107995096-107995118 GCAGAAAAGCATGAGGAGGGAGG - Intergenic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060867965 9:127014773-127014795 TTAGAAAAGGCTGATGAGGTGGG - Intronic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186363031 X:8862666-8862688 TTAGAAAGGGCTGATGAGGAAGG - Intergenic
1186588767 X:10905401-10905423 GGACAAAAGCCTGATTAGAATGG + Intergenic
1187106753 X:16251286-16251308 GGATGAAAGCCTGATGAGAATGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1188430421 X:30100724-30100746 ATAGAAAAGACTGATGTGGCAGG + Intergenic
1189231905 X:39459138-39459160 GGAGGAAAGACTGAAGAGGATGG + Intergenic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1190869028 X:54409645-54409667 CTATAATAGCCTTATGAGGAAGG + Intergenic
1193531619 X:82661097-82661119 GCAGAAAATCCTGATGAGGCTGG - Intergenic
1194641422 X:96407823-96407845 GAAGAAAAGGCTGAGGAGGAGGG + Intergenic
1195157774 X:102141213-102141235 GAAGAAAAGCCAGACGCGGAGGG - Exonic
1195157779 X:102141249-102141271 GAAGTAGAGCCTGATGATGAAGG - Exonic
1195308672 X:103609125-103609147 GAAGTAGAGCCTGATGATGAAGG + Exonic
1195308677 X:103609161-103609183 GAAGAAAAGCCAGACGTGGAGGG + Exonic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1198041088 X:132853057-132853079 GTAGAACAGTTTAATGAGGAAGG - Intronic
1198479698 X:137030343-137030365 GAAGAAAAGCCAGATGATTATGG + Exonic
1199486897 X:148358143-148358165 GTAGAAAAAAATGATCAGGAAGG - Intergenic