ID: 1171416218

View in Genome Browser
Species Human (GRCh38)
Location 20:24982468-24982490
Sequence AAGCAGAGCCTACTGGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171416218_1171416223 -3 Left 1171416218 20:24982468-24982490 CCAATCCCCAGTAGGCTCTGCTT 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1171416223 20:24982488-24982510 CTTCCTTTCAGTGTCTGGCCAGG 0: 1
1: 0
2: 0
3: 29
4: 236
1171416218_1171416222 -8 Left 1171416218 20:24982468-24982490 CCAATCCCCAGTAGGCTCTGCTT 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1171416222 20:24982483-24982505 CTCTGCTTCCTTTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 31
4: 289
1171416218_1171416224 -2 Left 1171416218 20:24982468-24982490 CCAATCCCCAGTAGGCTCTGCTT 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1171416224 20:24982489-24982511 TTCCTTTCAGTGTCTGGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171416218 Original CRISPR AAGCAGAGCCTACTGGGGAT TGG (reversed) Intronic
900285711 1:1899366-1899388 GAGCAGAGGCTGCTGGGCATGGG + Intergenic
900462580 1:2808722-2808744 AAGCACAGCCTAATGGGGGTGGG - Intergenic
901617468 1:10553207-10553229 AAGCAGAATCTCCTGGGAATTGG + Intronic
901728527 1:11261558-11261580 AAGCTGAACATACTTGGGATAGG - Intronic
901860445 1:12070945-12070967 AAGGTGAGTCTACTGGGGAGTGG - Intronic
903740859 1:25557591-25557613 ATGCAGGGCCTTCTGGTGATTGG + Intronic
904211498 1:28889037-28889059 GTGCAGAGCCTACTGGGCACTGG - Intronic
905242271 1:36588785-36588807 AAGCAGAGCTTCCTGGGCAGGGG + Intergenic
905280766 1:36847554-36847576 AAGCTGAGCTCACTGGGGACTGG + Intronic
905341340 1:37280037-37280059 AAGCAGAGCCAACAAGAGATTGG + Intergenic
906551136 1:46667610-46667632 AAGGAAAGGCGACTGGGGATGGG - Intronic
909720838 1:78767601-78767623 AGGCAGAGCCTACCTGAGATGGG + Intergenic
911671029 1:100607809-100607831 AAGGAGAGCCTGCAGGGGACTGG + Intergenic
912932350 1:113975862-113975884 AAGTAGAAGGTACTGGGGATGGG + Exonic
913510390 1:119555893-119555915 AAGCAGAGCCTATTCGGCAGAGG - Intergenic
915366464 1:155319647-155319669 AAGAAGATCCTGCTGGAGATGGG + Exonic
915474320 1:156144187-156144209 AAGCAGAGCAGACTGGGGGTAGG - Intergenic
916750594 1:167720119-167720141 AAGCAGAGGGTACTGTGAATGGG + Intergenic
916820196 1:168390768-168390790 AAACAGAGGTTACTGGGGGTGGG + Intergenic
918649074 1:186937736-186937758 AAAAATAGCCTACTGGGGAGAGG + Intronic
918697674 1:187563755-187563777 AAGAAGATCCTGCTGGGGATGGG + Intergenic
919789426 1:201281014-201281036 AAGCAGATCCTTCTCTGGATAGG - Intergenic
919848535 1:201656833-201656855 AGGCAGAGCCCGCTGGGGTTTGG + Intronic
919849054 1:201660181-201660203 CAGCAGAGCCTATTTGGGGTGGG + Intronic
920831993 1:209473849-209473871 AAGAAGAGCCTAATGGGATTTGG - Intergenic
920932806 1:210404678-210404700 AGGTAGAGCCCGCTGGGGATGGG + Exonic
921071320 1:211660550-211660572 AAGAAGATCCTGCTGGAGATGGG - Intronic
921965835 1:221087959-221087981 TAACAGACCCTACTGGGCATTGG + Intergenic
1065918570 10:30371792-30371814 AGGCAGATCCTGCTGGAGATGGG - Intronic
1071403096 10:85297875-85297897 AAGCACAGCCTAACTGGGATTGG + Intergenic
1072787913 10:98296624-98296646 AACCAGAGCCCACAGGGGTTAGG + Intergenic
1074440607 10:113474433-113474455 TAGCATAAACTACTGGGGATGGG - Intergenic
1077138404 11:1012878-1012900 AAGGACAGGCTGCTGGGGATGGG + Exonic
1077545414 11:3167163-3167185 ATGCAGAGCCTGCTGGGAAGTGG - Intergenic
1078040705 11:7860134-7860156 CACCAGGGCCTACTGGGGGTGGG + Intergenic
1078293307 11:10038060-10038082 AAGCAGACCCTATTGTGTATAGG - Intronic
1079787699 11:24695975-24695997 AAGTAGAGATTACTTGGGATCGG + Intronic
1080699826 11:34635337-34635359 GAGCAGAGCCTCCTGGGTCTTGG + Intronic
1082724987 11:56723945-56723967 GAGCAAAGGCTACTGGTGATGGG + Intergenic
1083831275 11:65235407-65235429 TAGCAAGACCTACTGGGGATGGG - Intergenic
1085317196 11:75552818-75552840 AAGCAGAGAAGACTGGGAATAGG - Intergenic
1087269345 11:96095669-96095691 AAGCAGAGCTGACCTGGGATTGG - Intronic
1089400107 11:118159624-118159646 AAGCAGAGGCAACTGTGGTTGGG + Intergenic
1089634254 11:119802177-119802199 AAGGAGAGGCCACTGGGGGTTGG + Intergenic
1090649169 11:128791437-128791459 AAGCAAAGCATCCTGGGGAAGGG - Intronic
1091265835 11:134270353-134270375 AACCAGAGCATCCTGGGGCTGGG + Intergenic
1091271488 11:134314702-134314724 AAGCAGAGACTAATTGGAATGGG - Intronic
1092514408 12:9194189-9194211 AAGAAGAGTTTATTGGGGATGGG + Exonic
1092796860 12:12120249-12120271 GAGCTAAGCCTACTGGGGAATGG + Exonic
1094254581 12:28408140-28408162 CACCAGGGCCTACTGGGGGTTGG - Intronic
1096712619 12:53468520-53468542 AAGCCCAGCCTATTAGGGATGGG - Intronic
1096863469 12:54547023-54547045 AGGCAGAGCCTCCTAGGGGTAGG + Exonic
1098327846 12:69321397-69321419 AAGGAGAGCAAACTGGGGATGGG + Intergenic
1103191682 12:119006954-119006976 AGGCAGGGCCTGCTTGGGATTGG + Intronic
1104042152 12:125137613-125137635 AAGCAGAGCGTACTGGGGCCAGG - Intronic
1104265049 12:127224006-127224028 CAGCAGATCCCACTGGAGATGGG - Intergenic
1104980346 12:132570688-132570710 CAGCAGAGACTCCTGGGGAAAGG - Intronic
1111285150 13:86081367-86081389 AAGCAGAGATTGTTGGGGATGGG + Intergenic
1111375913 13:87379187-87379209 AAGCTGAGAATTCTGGGGATGGG + Intergenic
1112757828 13:102658908-102658930 AACCACAGCCTCCTGGGCATTGG - Intronic
1113010285 13:105757393-105757415 AAGCAAAGTTTGCTGGGGATGGG - Intergenic
1113652195 13:112041925-112041947 AATGAGAGCTTACTGGGAATAGG + Intergenic
1114231545 14:20787293-20787315 AAGCAGAAGCTCGTGGGGATGGG + Intergenic
1118068480 14:62218452-62218474 CACCAGAGCCTACTTGAGATGGG - Intergenic
1118841987 14:69520287-69520309 AGGCAGAGCCCACTGAGGAGAGG + Intronic
1119872049 14:78026419-78026441 AAACAGAACCAACAGGGGATAGG - Intergenic
1120075853 14:80157564-80157586 AACCAGATCATACTGGGTATTGG + Intergenic
1121790589 14:96696749-96696771 AGGAACAGCCTGCTGGGGATGGG + Intergenic
1121838314 14:97111936-97111958 AATCAGAGATTACAGGGGATGGG + Intergenic
1124068502 15:26369089-26369111 AAGAAGAGCTTACTGTGGCTGGG - Intergenic
1125854950 15:42939669-42939691 AAGAAGATCCTGCTGGAGATGGG - Intergenic
1125875490 15:43140510-43140532 AAGAAGATCCTGCTGGAGATGGG - Intronic
1126061881 15:44790789-44790811 TAGCAGAGTCTACTGGGGATTGG - Intergenic
1128616989 15:69118028-69118050 ATGCAGATGCTGCTGGGGATGGG - Intergenic
1129072324 15:72961648-72961670 AAGCAGAGCCTTCTGCTTATAGG - Intergenic
1129671552 15:77610644-77610666 AAGCAGAGAGGACTGGGGACTGG - Intergenic
1129888698 15:79056834-79056856 ATGCAGAGCCTTCTGAGCATAGG - Intronic
1130823641 15:87520986-87521008 AAGGAGAGATTACTGGGAATGGG - Intergenic
1131590975 15:93747562-93747584 AAGCTGAGGCAACTGGGGTTTGG + Intergenic
1132371759 15:101304490-101304512 ATGCAGAGCCTTCTGAGGAGAGG - Exonic
1132851953 16:2028784-2028806 AAGCAGTGCCCACTGGGAAGTGG - Intronic
1134704275 16:16291280-16291302 AAGCTGTGCCTGCTGGGGCTTGG + Intronic
1134963268 16:18420834-18420856 AAGCTGTGCCTGCTGGGGCTTGG - Intronic
1134967563 16:18503433-18503455 AAGCTGTGCCTGCTGGGGCTTGG - Intronic
1137559469 16:49493464-49493486 CAGCTGTGCCTGCTGGGGATTGG - Intronic
1137977162 16:53041819-53041841 TTGCACAGCTTACTGGGGATAGG - Intergenic
1138443919 16:57051449-57051471 AGCCAGAGCCTTCTGGAGATGGG - Intronic
1140396717 16:74633576-74633598 AAGCAGTGACTGCTGGGGATGGG + Intronic
1141847649 16:86621884-86621906 AAGCAGACCGTGCTGGGGTTTGG - Intergenic
1145180026 17:20740562-20740584 ATGCAAAGCCAACTTGGGATAGG - Intergenic
1145880062 17:28346470-28346492 AAGCAGGGACTAAAGGGGATGGG - Exonic
1147899123 17:43772410-43772432 ACACAGAGCCTACTGGGAAAGGG + Intronic
1150995112 17:70308095-70308117 AAATAGAGCCCACTGGGGACTGG + Intergenic
1151747273 17:76018312-76018334 AAGCTGCGTCTACTGGGGCTGGG - Intronic
1152430590 17:80246412-80246434 CAGCAGAGCCCACTGGGGACAGG - Intronic
1155249007 18:23938035-23938057 AAGCAGAGCCAACTCCTGATGGG - Intronic
1158542649 18:58370686-58370708 AAGCAGAGGCAACTGGGATTTGG - Intronic
1158640395 18:59198388-59198410 AAGCAGAACATGCTGGGGGTGGG + Intergenic
1159391615 18:67800808-67800830 AAGTATAGCCTACTTTGGATTGG + Intergenic
1161792111 19:6366342-6366364 AAACAGAGCCTGCAGGTGATCGG + Exonic
1161841968 19:6687528-6687550 AAACACAGCCTTCTGGGGATGGG + Intronic
1162992413 19:14312213-14312235 GACCAGAGCTTCCTGGGGATTGG + Intergenic
1165632319 19:37312358-37312380 AATCTGAGGCTACTGGGGAAAGG - Intergenic
1165936427 19:39391624-39391646 AAGGAGAGTCTACAGGTGATTGG + Exonic
927651307 2:24915244-24915266 AGCCAGAGCCGACAGGGGATGGG + Intronic
929426739 2:41851682-41851704 AAGGAGCTCCTCCTGGGGATGGG - Intergenic
931447875 2:62342010-62342032 AAGCAGAGGCTCCTGGGAAAGGG - Intergenic
932872379 2:75414979-75415001 AGGAAGACCATACTGGGGATAGG - Intergenic
936663252 2:114565692-114565714 AAGACAAGCCTCCTGGGGATAGG - Intronic
938765698 2:134459522-134459544 AAGAAGAGTTCACTGGGGATGGG - Intronic
940205032 2:151193251-151193273 AAGTATACCCTACTGGGGAATGG + Intergenic
941353917 2:164465868-164465890 TAGCTGAGCCTAGTGGGGATGGG - Intergenic
943509130 2:188802691-188802713 ATGCTGCCCCTACTGGGGATGGG - Intergenic
944074503 2:195713748-195713770 ATGCAAAGCCAACTTGGGATAGG + Intronic
944580455 2:201127603-201127625 AAGGAGAGCATACTAGGGAGAGG - Intronic
945145822 2:206736884-206736906 AAGTAGAGACTTCTGGGGATGGG + Intergenic
947972226 2:234333803-234333825 AAGCAGCCCCTAATGGGGTTAGG - Intergenic
948011740 2:234654225-234654247 AAGGAGAGCCCACTGAGGAAGGG + Intergenic
948924154 2:241083144-241083166 CAGGAGAGCCTGCTGGGGATGGG + Intronic
949005198 2:241642145-241642167 ATGCAGAGGCTGCTGGGGAGTGG + Intronic
1168753739 20:301334-301356 AAGCAGATCCTGTGGGGGATGGG - Intergenic
1170145873 20:13173758-13173780 AAAGTGAGCCAACTGGGGATTGG + Intergenic
1170639574 20:18139491-18139513 AACCAGAATCTCCTGGGGATGGG + Intronic
1171416218 20:24982468-24982490 AAGCAGAGCCTACTGGGGATTGG - Intronic
1172572219 20:35979628-35979650 AGCAAGAGCCTACTGGGGAAGGG + Intronic
1172841736 20:37906069-37906091 AAGCAGGGGCTCCTGGGGAGGGG + Intronic
1173263275 20:41455525-41455547 AAACAGAGCCAACTGAGAATAGG + Intronic
1173341930 20:42160844-42160866 AAGCATTGCCTTCGGGGGATGGG + Intronic
1173409379 20:42796149-42796171 AAGCAGAGACTACAGGGTCTAGG + Intronic
1180021732 21:45132848-45132870 AAGCAGAGTCTACTGGATTTAGG + Intronic
1182792860 22:32967506-32967528 AAGCAGAGTCTCCTGAGGAGGGG - Intronic
1184404777 22:44293557-44293579 AGGCAGATCCTACTGAGGAGAGG - Intronic
1184512912 22:44943496-44943518 TAGCTGAGCCTGCTGGAGATCGG - Intronic
1184674554 22:46033894-46033916 AAGCAGTGCTTACTGGGCACTGG - Intergenic
1185103395 22:48853733-48853755 GAGCTGGGCCTGCTGGGGATGGG + Intergenic
950718202 3:14864420-14864442 AAGCATCGCCTTCTGGGGACTGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
952325197 3:32314432-32314454 AGGCAGGTCCTACTGGGGAGAGG + Intronic
952526400 3:34215119-34215141 TAGCAGAGTCTACTGGGGATTGG + Intergenic
952943810 3:38462406-38462428 AAACAGGGCTTGCTGGGGATGGG - Intronic
953642526 3:44722612-44722634 ATGCAGAGCCTACTTGAGGTGGG + Exonic
956621953 3:71230101-71230123 AAGCAGACACCACTGGGGAGGGG + Intronic
956892632 3:73627086-73627108 AGCCATAGCCTACTGTGGATTGG + Intergenic
958731770 3:97967561-97967583 AAGCAAAGCCTACAGGGAGTGGG - Exonic
959909462 3:111747615-111747637 AGTCAGAGGCTACTGGGGATTGG - Intronic
960994568 3:123332425-123332447 GAGCAGAGCCTGCTGGTGATGGG - Intronic
961118459 3:124351904-124351926 AAGCTGAGCTGACTGGGGAAAGG + Intronic
962234815 3:133698926-133698948 ATGCAGAGCCTGCTGGGAAAAGG - Intergenic
963442316 3:145355842-145355864 AAGCTGAAGCTATTGGGGATGGG + Intergenic
964525447 3:157611797-157611819 ATGCAGTGCCTAATGGGGACAGG + Intronic
967715015 3:192752742-192752764 CACCAGAGCCTGCTGGGGGTGGG + Intronic
968911460 4:3478768-3478790 CAGCAGGGCCTGCTGGGGACAGG - Intronic
968932543 4:3588825-3588847 AAGCAGTGCCACCTGGGGTTGGG + Intronic
971873989 4:32280734-32280756 CACCAGAGCCTTCTGGGGGTGGG + Intergenic
972221866 4:36965215-36965237 TGGCAGAGGCTACTTGGGATTGG - Intergenic
972638020 4:40901427-40901449 ATGCAGAGCCTGGTGGGGGTGGG + Intronic
972805624 4:42527434-42527456 AAGTTGCCCCTACTGGGGATGGG - Intronic
974473277 4:62346602-62346624 AAGAAGGGTCTACTGGGGCTGGG - Intergenic
976890068 4:90035708-90035730 CAGCAGGGCCTGTTGGGGATAGG + Intergenic
978382513 4:108144419-108144441 AAGCAGATCCCCCTGGGAATTGG + Intronic
982827479 4:160019134-160019156 AAGCTGAGCCTGCTGGAAATGGG - Intergenic
985550918 5:533272-533294 AAGCAGAGCCCAGTGGTGCTGGG + Intergenic
985587520 5:748629-748651 GACCAGAGCTTGCTGGGGATGGG + Intronic
985602078 5:840720-840742 GACCAGAGCGTGCTGGGGATGGG + Intronic
995092091 5:108189818-108189840 TATGAGAGCCTTCTGGGGATTGG + Intronic
995488905 5:112669221-112669243 AAGTAGAGCTGTCTGGGGATAGG - Intergenic
997431906 5:133846748-133846770 CAACAGAGCCTCCTGGGGAGGGG + Intergenic
1002373296 5:178771360-178771382 AAGCAGAGTGTACTGGGGCGGGG + Intergenic
1003307310 6:4941244-4941266 AAGCAGGGGCTACTTGGGAGAGG + Intronic
1004467843 6:15902419-15902441 AACCAGAACCTACTTGGGAGTGG + Intergenic
1005731016 6:28696751-28696773 AAGCAGTGCCACCGGGGGATTGG + Intergenic
1006743072 6:36323072-36323094 GAGCAGGGCCTACTGGGGGTGGG + Intronic
1007258141 6:40542788-40542810 AAGCCCAGCCCTCTGGGGATGGG - Intronic
1009350995 6:62678464-62678486 TAGCTGAGTCCACTGGGGATTGG + Intergenic
1010773364 6:79858121-79858143 AATCAGACCCTACAGGTGATTGG - Intergenic
1013240957 6:108245116-108245138 CACCAGGGCCTGCTGGGGATTGG - Intronic
1013286354 6:108685565-108685587 TGCCAAAGCCTACTGGGGATGGG + Intergenic
1013368449 6:109451613-109451635 AAGCAGTGCCTGCTGCGGCTGGG - Exonic
1017448997 6:154536457-154536479 AAGCAGAGACTGCCGGGGGTTGG - Intergenic
1017866924 6:158452009-158452031 ATGCAGATCCTACTCTGGATTGG - Intronic
1022593214 7:31686282-31686304 GAGGAGAGCCCACTGGGGTTTGG - Intergenic
1026848793 7:73712193-73712215 AAGCAAAACCTAGAGGGGATGGG + Intronic
1030471369 7:109966654-109966676 AAGCAGAGCCTACTACCGCTGGG + Intergenic
1033143958 7:138855029-138855051 ATGCTGAGCATTCTGGGGATGGG - Intronic
1037635884 8:20700823-20700845 AAGCAGAGCCTATGAGGGCTTGG - Intergenic
1039170006 8:34733841-34733863 AAAGAGAGACTACTGGGTATGGG - Intergenic
1039316112 8:36374394-36374416 GAGCTGAGCCTACTGGGAAGAGG - Intergenic
1041268186 8:56085068-56085090 AGGCAGAGACAACTGGAGATTGG + Intergenic
1042334485 8:67615721-67615743 TAAGAAAGCCTACTGGGGATGGG + Intronic
1044538450 8:93383712-93383734 AAGCAGAGGCTCCTGGGGTTTGG - Intergenic
1045986711 8:108257504-108257526 GAGCAGAGCTTACTGTGGAAGGG - Intronic
1047219292 8:122906582-122906604 AAGCAGTTACTTCTGGGGATTGG + Intronic
1048486391 8:134851729-134851751 GAGCAGAATCTGCTGGGGATCGG - Intergenic
1050170759 9:2813952-2813974 TAGGAGAGCATAATGGGGATTGG - Intronic
1054457582 9:65443071-65443093 AAGCAGTGCCACCTGGGGTTGGG - Intergenic
1056100166 9:83293455-83293477 AAGCAGTGATTCCTGGGGATAGG - Intronic
1057222580 9:93265218-93265240 CAGCAGAGACCACAGGGGATTGG + Intronic
1061574360 9:131496856-131496878 AAGCAGAGCCCACGGGGCCTGGG - Exonic
1061715754 9:132517920-132517942 AATCAGCTCCTACTTGGGATAGG - Intronic
1062490132 9:136800983-136801005 AAGCAGAACCTACTCCAGATGGG + Intronic
1189487724 X:41445906-41445928 AAGAAGAGAATACTAGGGATGGG - Intergenic
1189776705 X:44476382-44476404 AAGAAGATCCTGCTGGAGATGGG - Intergenic
1189911309 X:45813049-45813071 CACCAGGGCCTACTGGGGGTGGG - Intergenic
1190063667 X:47226209-47226231 GAGCAGTGCCTGCTGGGGGTCGG + Intronic
1191811814 X:65197108-65197130 ACAAAGAGCCTACTGGGGAAAGG + Intergenic
1192410029 X:70925935-70925957 TAGCAAAGCCTAGTGGGGAAAGG + Exonic
1193914101 X:87344199-87344221 AAACAGAGCCTATGGGGGAGGGG + Intergenic
1196485008 X:116196395-116196417 AAGCAACTTCTACTGGGGATGGG - Intergenic
1198361847 X:135903215-135903237 AAGCAGAGCCTCCTGTGCAGAGG - Intronic