ID: 1171416426

View in Genome Browser
Species Human (GRCh38)
Location 20:24984127-24984149
Sequence GAGGTCGGCCAGCTTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171416426_1171416432 17 Left 1171416426 20:24984127-24984149 CCCACTGCAAGCTGGCCGACCTC 0: 1
1: 0
2: 2
3: 9
4: 91
Right 1171416432 20:24984167-24984189 CTAGCACTATTTGCTAGGATTGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171416426_1171416431 12 Left 1171416426 20:24984127-24984149 CCCACTGCAAGCTGGCCGACCTC 0: 1
1: 0
2: 2
3: 9
4: 91
Right 1171416431 20:24984162-24984184 AAACTCTAGCACTATTTGCTAGG 0: 1
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171416426 Original CRISPR GAGGTCGGCCAGCTTGCAGT GGG (reversed) Intronic
900814194 1:4830902-4830924 GAGGTCGAGCAGCTGGCAGCTGG - Intergenic
902117882 1:14136884-14136906 GAGGTCATCAAGCTTTCAGTGGG + Intergenic
904645141 1:31959892-31959914 TAGGGCTGCCAGTTTGCAGTTGG + Intergenic
909554833 1:76941898-76941920 GAGGAGGGCCACCTTGCAGCTGG - Intronic
913102926 1:115585979-115586001 TAGGTGGGCCAGCTGGAAGTGGG + Intergenic
922860110 1:228809387-228809409 AAGGTCTGCCTGCTTGCATTGGG + Intergenic
922908726 1:229197603-229197625 TAGGCCGTCCAGCCTGCAGTGGG + Intergenic
1064162849 10:12960640-12960662 GAGGTGGGGCAGGGTGCAGTCGG + Intronic
1067729727 10:48801576-48801598 GAGGTGGGCCAGCTGCCATTTGG - Intronic
1075077701 10:119362029-119362051 GAGGTGGGACAGCTTGCAGCTGG - Intronic
1076408460 10:130229633-130229655 AAGGTCGGACATCTTGAAGTGGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1081182382 11:39999872-39999894 GAGGTGGGACAACTTGGAGTGGG - Intergenic
1082839538 11:57677717-57677739 GAGGTCGGCCAACTTCCTGTGGG - Intronic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1085319784 11:75566891-75566913 GACCTCGGGCAGCTTGCCGTCGG - Exonic
1088913779 11:114211756-114211778 CAGGAAGGCCAGCTTGCAGTGGG + Intronic
1092420138 12:8324286-8324308 AAGGACGGCCGGCTTGTAGTGGG - Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096552205 12:52380497-52380519 CAGATCTGCCAGCTTGCATTTGG + Exonic
1096781620 12:53995375-53995397 GAGGCCAGACAGCTCGCAGTCGG + Intronic
1096977287 12:55706891-55706913 CAGGTCTGCCAACCTGCAGTAGG - Intronic
1103917744 12:124384659-124384681 GAGGTCACACAGCCTGCAGTGGG - Intronic
1106082723 13:26513961-26513983 AAGGTCAGCCAGATTGCAGTTGG + Intergenic
1110579040 13:77097456-77097478 GAGATGGCCCAGCTGGCAGTAGG - Exonic
1113064236 13:106357675-106357697 GAGGACAGCCAGCCTGCATTGGG + Intergenic
1114247201 14:20925718-20925740 TGGGTCTGCCAGCTTGCAGAGGG - Intergenic
1114481123 14:23035209-23035231 GAGGTCGGCCATCTTTGAGAAGG + Intronic
1121311420 14:92937399-92937421 GGGGTCGGCCAGGCTGCAGGAGG + Exonic
1122028115 14:98892377-98892399 GAGGTCTCCCAGCTTGCATGGGG - Intergenic
1123125195 14:105941214-105941236 CAGATCAGCCAGCCTGCAGTGGG - Intergenic
1126370152 15:47937738-47937760 GAGGACAGCCAGGTTTCAGTTGG + Intergenic
1128549624 15:68589982-68590004 CAGGACGGCCAGCTTCCAGGAGG - Intronic
1128813600 15:70589106-70589128 GATGTCTGCCAGCTCCCAGTGGG + Intergenic
1130352028 15:83101352-83101374 GTGGTCGGAAGGCTTGCAGTTGG - Intergenic
1130706038 15:86233843-86233865 GAGGAGGGTCAGCTTCCAGTTGG + Intronic
1131133463 15:89914600-89914622 CAGGTAGGCCAGCTAGGAGTGGG - Intergenic
1136508588 16:30722244-30722266 CAGGTGCGCCAGCTTGCTGTGGG + Exonic
1139649923 16:68357073-68357095 GTAGACGGCCTGCTTGCAGTGGG - Exonic
1139958490 16:70704621-70704643 GAGGAGGGCCAGCTCACAGTGGG + Intronic
1140245090 16:73241094-73241116 GAGGTCCTTCAGCTTCCAGTGGG - Intergenic
1147789786 17:43006615-43006637 GATGGGGGCCAGTTTGCAGTTGG + Intergenic
1148438410 17:47699313-47699335 GAGCCCGGCCAGCCTGCTGTCGG - Exonic
1148691426 17:49529096-49529118 GAGGGAGGCCAGCTTGCAGTGGG - Intergenic
1151529433 17:74695162-74695184 GAGGTGGCCCATGTTGCAGTAGG + Exonic
1157959385 18:52135363-52135385 GTGGTTGGTCAGCTGGCAGTGGG - Intergenic
1160821473 19:1060842-1060864 GAGGTTGGCCAGCACACAGTAGG - Intronic
927787071 2:25981699-25981721 CAGGTCGGCCTGCTTGGAGCTGG + Exonic
928112541 2:28522307-28522329 GAGCTCTGCCTGCTTTCAGTGGG - Intronic
935943667 2:108267664-108267686 GAGGTCGGGCAGGATGCAGGGGG - Intergenic
940507731 2:154577664-154577686 AAGGTCGGCCGGCTTGTAGGGGG - Intergenic
946563167 2:220935917-220935939 GAGGTGGGACAGCGTCCAGTAGG + Intergenic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1171908246 20:30919320-30919342 GATGTCAGCAAGCTTGCAGAAGG - Intergenic
1175780135 20:61676919-61676941 GTGGTGGGCCAGGCTGCAGTGGG + Intronic
1180341684 22:11625482-11625504 GATGTCAGCAAGCTTGCAGAAGG - Intergenic
950536798 3:13583567-13583589 GAGGCCTGCCAGCTTGCCCTGGG - Intronic
954107325 3:48416301-48416323 GAGGTTGGCCCGCTGGCAGCTGG + Intronic
964736968 3:159927643-159927665 GAGGCCTGGCAGCTTCCAGTGGG - Intergenic
967535829 3:190601807-190601829 GAGGTGGGCCAGCTGCCAGCTGG + Intronic
969918202 4:10510843-10510865 AAGGTGGGACAGCTTGAAGTGGG - Intronic
976812003 4:89108403-89108425 GAGCTGGGCCACCTTGCAGGTGG + Intronic
976896267 4:90115815-90115837 GAGATCGGCCAGCTACCAGGTGG + Intergenic
987332171 5:16866939-16866961 CAGGTCGGGCAGCTGGCAGGAGG - Intronic
988040559 5:25883873-25883895 AAGGTGGGCCATCTTGAAGTGGG - Intergenic
989189414 5:38655462-38655484 GAGTTTGGCAAGCTTTCAGTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995629471 5:114117689-114117711 GAGGTGGGAAAGCTTTCAGTGGG + Intergenic
996708213 5:126518581-126518603 GAGGTGGGACAACTTGAAGTGGG - Intergenic
997266100 5:132496273-132496295 GAAGCCGGCCAGCTTGGAGCCGG - Intergenic
997612832 5:135227205-135227227 GAGGTCAGCCAACTTGCTGAAGG + Intronic
1000600981 5:163274159-163274181 AAGGAGGGACAGCTTGCAGTGGG + Intergenic
1001639519 5:173234931-173234953 GAAGGCGGCCAGCATGCAGGAGG + Exonic
1007820926 6:44560003-44560025 GAGGTAGGCCAGCGGGCAGGCGG - Intergenic
1009926873 6:70130631-70130653 GAGGGTGTCCAGCCTGCAGTGGG + Intronic
1011130058 6:84043476-84043498 GAGGAAGTCCAGCTTGCAGGTGG + Intronic
1013117915 6:107115942-107115964 GAGGGCGGCCACCGTGCAGGGGG - Intergenic
1013707620 6:112857198-112857220 GAAGTCGGCCAGCTTTGAATGGG + Intergenic
1014848816 6:126314238-126314260 GAGGTGGGACAACTTGAAGTGGG - Intergenic
1019770801 7:2882729-2882751 GAGCTCTGCCAGGTTGCAGGGGG + Intergenic
1024780369 7:52841010-52841032 GGGGTCTGCCTGCTGGCAGTAGG - Intergenic
1026552566 7:71380822-71380844 GAGGTAGGTAAGCTTGCAGGAGG + Intronic
1029211057 7:98908736-98908758 GAGGTCGGCCAGCGTGCTGTAGG - Exonic
1038293971 8:26274062-26274084 GAGGTGGGACAACTTGAAGTAGG - Intergenic
1042500232 8:69500760-69500782 GAGGTGGGCCACATTGCAGAGGG + Intronic
1043074140 8:75674416-75674438 GTGGTTCTCCAGCTTGCAGTTGG + Intergenic
1044276133 8:90301285-90301307 AAGGTCAGCCTGCCTGCAGTGGG - Intergenic
1049576579 8:143392542-143392564 CTGGGCGGCCAGTTTGCAGTAGG - Intergenic
1052875240 9:33554820-33554842 GAGGTGGGCTAGCTTGAAGCAGG + Intronic
1055788668 9:79898421-79898443 TAGGTCAGCCAGGTTGCTGTAGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1203774517 EBV:65320-65342 GATGTTGGCCAGATTGCAGGTGG - Intergenic
1188483125 X:30653917-30653939 CAGAGCGGCCCGCTTGCAGTAGG + Intronic
1197568728 X:128121512-128121534 AAGGTGGGACAGCTTGAAGTGGG + Intergenic
1200133039 X:153861929-153861951 GAGGCCGGCCAGTGGGCAGTGGG + Exonic
1202073175 Y:21013711-21013733 GGTGTGGGCTAGCTTGCAGTAGG + Intergenic
1202077875 Y:21055565-21055587 GGTGTGGGCTAGCTTGCAGTAGG + Intergenic