ID: 1171417377

View in Genome Browser
Species Human (GRCh38)
Location 20:24992346-24992368
Sequence CCCAGTCGCCGCGTTGTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171417377_1171417384 12 Left 1171417377 20:24992346-24992368 CCGAGGACAACGCGGCGACTGGG No data
Right 1171417384 20:24992381-24992403 CCGAACCTGAAAGACCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1171417377_1171417381 8 Left 1171417377 20:24992346-24992368 CCGAGGACAACGCGGCGACTGGG No data
Right 1171417381 20:24992377-24992399 GCACCCGAACCTGAAAGACCTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1171417377_1171417387 29 Left 1171417377 20:24992346-24992368 CCGAGGACAACGCGGCGACTGGG No data
Right 1171417387 20:24992398-24992420 GGCAGGTACATCCGCCTTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171417377 Original CRISPR CCCAGTCGCCGCGTTGTCCT CGG (reversed) Intronic