ID: 1171421134

View in Genome Browser
Species Human (GRCh38)
Location 20:25018431-25018453
Sequence AACCCCATACTCTTTCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171421133_1171421134 -10 Left 1171421133 20:25018418-25018440 CCATCTAGAAAGGAACCCCATAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1171421134 20:25018431-25018453 AACCCCATACTCTTTCTGAGAGG 0: 1
1: 0
2: 2
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171421134 Original CRISPR AACCCCATACTCTTTCTGAG AGG Intronic
901611526 1:10502340-10502362 AGCCTCATACTGTTTCTGGGTGG + Intronic
904478088 1:30777401-30777423 ATCCCCCTAATCTTTCTCAGGGG + Intergenic
906182240 1:43832027-43832049 AAACACATCCTCTTTCTGGGTGG - Intronic
906583326 1:46954378-46954400 AGCCCCATCCCCTTTCTTAGTGG + Intergenic
908161778 1:61416460-61416482 AACCCCATGCTCTCTGTGAGGGG - Intronic
909135184 1:71789828-71789850 AACCCCTTCTTCTTTCTGAAAGG + Intronic
919114239 1:193260606-193260628 AACTCCATCCTGTTACTGAGGGG - Intergenic
921718179 1:218440072-218440094 AACCCCATTCTGTATCAGAGGGG - Intronic
923973003 1:239226564-239226586 GATCCCATACTCTGTCTCAGTGG + Intergenic
1064553157 10:16521976-16521998 AATGCCAAACTCTCTCTGAGTGG - Exonic
1065777555 10:29135077-29135099 GACCCCATACTCTTCCTAAAGGG + Intergenic
1066622386 10:37371092-37371114 AACGCTTTACTCATTCTGAGAGG - Intronic
1069071822 10:63997541-63997563 AAAGGCATACTCATTCTGAGTGG - Intergenic
1072813441 10:98481840-98481862 CATCCCATACCCTTCCTGAGAGG + Intronic
1073072717 10:100805144-100805166 AACCCCATGCTCGGTCTGGGAGG + Intronic
1076350013 10:129809237-129809259 ATCCCCATACACTTTCTGAGAGG - Intergenic
1080207790 11:29751018-29751040 AATCACATACTCTTTGGGAGAGG - Intergenic
1081220989 11:40461243-40461265 AAGCCCATACACTTTCTGTAAGG - Intronic
1086842729 11:91707452-91707474 AACTGCATACCCTTTCTGATGGG - Intergenic
1088894326 11:114066369-114066391 AACCTCAGTCTATTTCTGAGCGG - Intronic
1089519407 11:119053959-119053981 TTCCCCTTACTCTTTGTGAGTGG + Intronic
1089948783 11:122506169-122506191 AACCACATACGTTTTCTAAGTGG - Intergenic
1097309518 12:58103056-58103078 TACCCCATCCTCCTTCTGACAGG + Intergenic
1099674843 12:85745505-85745527 AAACCCATACGCATGCTGAGTGG + Intergenic
1100360219 12:93870764-93870786 AACCCCAAACTCCTTTTGAGTGG + Intronic
1100769806 12:97909440-97909462 AAGCCCATACTCTCTCTGTCTGG - Intergenic
1101447902 12:104750958-104750980 TACCCCAGAGTCTTCCTGAGGGG + Intronic
1102807299 12:115793228-115793250 AACCCCATACACTTCCTATGTGG - Intergenic
1104669788 12:130672732-130672754 ACACCCATTCTGTTTCTGAGCGG - Intronic
1107164828 13:37271888-37271910 GCCCACAGACTCTTTCTGAGAGG + Intergenic
1111410119 13:87864798-87864820 AGCTACATACTCTTCCTGAGTGG + Intergenic
1115532595 14:34341059-34341081 TACCACCTATTCTTTCTGAGGGG - Intronic
1116324338 14:43512615-43512637 GACCCCCTACTCTTTAAGAGTGG - Intergenic
1116469577 14:45271423-45271445 AAACCCTTTCTCTTTCTGTGTGG + Intergenic
1118047783 14:61990732-61990754 AACCCCATTTTCTATCTGATGGG - Intergenic
1125252829 15:37725655-37725677 AACCCCACACTCCTTCTCAGTGG + Intergenic
1127305230 15:57699165-57699187 AATTCCAAACTCTTTCTGATTGG - Intronic
1130815847 15:87431876-87431898 CACACCATCCTCTTTGTGAGTGG + Intergenic
1138222963 16:55268682-55268704 TGCCACATACTCTTTCAGAGTGG + Intergenic
1139282485 16:65782843-65782865 AGCCCCATGGTCCTTCTGAGGGG - Intergenic
1142992608 17:3741436-3741458 AACCCCATTCTCTTTCACTGGGG - Intronic
1145853064 17:28122332-28122354 AAACACTTACTCTTTCAGAGAGG - Intronic
1149713061 17:58760384-58760406 AACCTGATACTCTTTCTGGTGGG + Intronic
1158477341 18:57791897-57791919 AACCCCATAAGCTCCCTGAGGGG + Intronic
1158633321 18:59134977-59134999 TACCCCTTACCCTCTCTGAGAGG + Intergenic
1159585063 18:70276004-70276026 AACCTAAAAATCTTTCTGAGTGG + Intergenic
1162683680 19:12364993-12365015 AACCGCATTCTCCTGCTGAGTGG - Exonic
1166660630 19:44644443-44644465 AACTCCATCCCCTTTCCGAGGGG - Intronic
1168319593 19:55500986-55501008 GACCCCATCCTCTTTCTCAGAGG - Intronic
927201301 2:20579611-20579633 TAACCCATACTCTTTCTGGGAGG + Intronic
928923221 2:36548083-36548105 CACTCCATACACTTTATGAGCGG - Intronic
930825409 2:55692534-55692556 AAGCCCATACTTTTTTTTAGGGG - Intronic
931098071 2:58964611-58964633 TATCTCATACTGTTTCTGAGAGG + Intergenic
931589199 2:63862775-63862797 AACACCATACTTTCTCTGTGGGG - Intronic
932137394 2:69243207-69243229 CACCCCCTACTTTTCCTGAGTGG + Intronic
935208126 2:100914272-100914294 AGCCCCATACTCTTACAAAGGGG - Intronic
935875841 2:107506177-107506199 AACTCCCTCCTCTCTCTGAGGGG + Intergenic
936522630 2:113220627-113220649 AACCCCATACCCCTGCTGTGGGG - Intronic
938695431 2:133830890-133830912 GACCCCATGGCCTTTCTGAGGGG - Intergenic
938795741 2:134717739-134717761 AACCACAGATTCGTTCTGAGGGG + Intronic
942223080 2:173790251-173790273 GACCCCCTACCCTTTCTGTGGGG - Intergenic
946041297 2:216784967-216784989 AGGGCCATACTCTCTCTGAGGGG + Intergenic
946680387 2:222208572-222208594 AGCCTCAAACTCTTTCTGGGAGG + Intronic
946965972 2:225038546-225038568 TACCCCTTACACTTTCTGGGTGG + Intronic
948859124 2:240744396-240744418 AACCCATAACTCTTGCTGAGTGG - Intronic
1169987151 20:11458066-11458088 AACCCAATATTCTTTCTCAGCGG + Intergenic
1171421134 20:25018431-25018453 AACCCCATACTCTTTCTGAGAGG + Intronic
1177830664 21:26135298-26135320 ACCCCCATACCCTTTCTGAGTGG - Intronic
1178370409 21:32022334-32022356 AACCACTTCCTCTTTTTGAGTGG + Intronic
1179067869 21:38043298-38043320 AACCAAAAACTCTTGCTGAGTGG + Intronic
1179983755 21:44910170-44910192 AACTCCATTTTCTTTTTGAGGGG - Intronic
1182471479 22:30551124-30551146 GACCCCATACTTTTTCAGGGTGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
953449283 3:42992593-42992615 CATCCCAAACTCCTTCTGAGGGG - Intronic
954204434 3:49047817-49047839 TACCCCAGAATCTCTCTGAGGGG + Intronic
954746823 3:52792120-52792142 AACCCCTTAGTCCATCTGAGGGG - Intergenic
957616512 3:82534932-82534954 AGCCCCATTCTCTTTGTAAGAGG - Intergenic
960621130 3:119637813-119637835 ACCCCCATACTCTTCTTAAGGGG - Intronic
962419137 3:135212689-135212711 AACCCCACTGTCTTTCTGACTGG - Intronic
964030107 3:152128451-152128473 AAACACATACTCTTGCAGAGAGG - Intergenic
964691136 3:159451199-159451221 AACACCATTCTCTATCTGAAGGG + Intronic
966724704 3:183099213-183099235 AACCCCAGGCACTTTCGGAGGGG - Intronic
966800250 3:183756825-183756847 AAGCCAATACTCTTTCTCTGAGG + Intronic
967497490 3:190158106-190158128 AACATCCTACTCTTTCTGAATGG - Intergenic
970454122 4:16205087-16205109 AACGCCAGCCTCTTTCTGTGGGG + Intronic
972071841 4:35030114-35030136 AACTCCAAACTCATTCTGACAGG - Intergenic
982750659 4:159157479-159157501 AAACCCATACTCTTTTAAAGTGG + Intronic
985493996 5:194269-194291 CACCCCGTCCACTTTCTGAGTGG + Intronic
990420223 5:55624645-55624667 AAATCCATACACTATCTGAGAGG + Intergenic
997737168 5:136221927-136221949 ACCCACATACTCACTCTGAGAGG - Intronic
1001593075 5:172879718-172879740 GATCCCATGCTCTCTCTGAGGGG - Intronic
1004071063 6:12298354-12298376 AATCTCAAACTCTTTCTCAGAGG - Intergenic
1005704246 6:28435807-28435829 AACCCCATACTTGTTCTTATAGG + Intronic
1006954490 6:37855525-37855547 AACCCCATATTCTTTGACAGAGG + Intronic
1006988845 6:38195562-38195584 AACCCCATACTGGCTCTGACTGG + Intronic
1008888442 6:56457145-56457167 AACCCCTAGCTCTTTCGGAGGGG + Intergenic
1010454377 6:76038381-76038403 AATCTCAGACTCTTTCTGAGGGG + Intronic
1011212375 6:84968052-84968074 ATCCCCATTCTCTTTCTGAAAGG - Intergenic
1013307061 6:108859153-108859175 AACCCCAAACTCTTCCCCAGTGG + Intronic
1015569262 6:134604612-134604634 AAGCCCATCCCTTTTCTGAGGGG - Intergenic
1015650433 6:135451586-135451608 AATACCTTACTCTTTCTGGGGGG + Intronic
1017219631 6:151950742-151950764 AAGGCCATACTCTCTCTGAGGGG - Intronic
1017447033 6:154516497-154516519 AACCCCATACTCCATCTGGCTGG - Intergenic
1017782485 6:157726933-157726955 AAGTCCATCCTCTTCCTGAGTGG - Intronic
1017785920 6:157757255-157757277 AGCCCCATACTCTTTGTATGAGG + Intronic
1018943385 6:168326749-168326771 GAGCCCAAACTCTTTCTCAGAGG - Intergenic
1024221902 7:47295511-47295533 AACACGATGCTATTTCTGAGTGG - Intronic
1026944447 7:74306880-74306902 AACCCCAGACTTTCTCCGAGTGG - Intronic
1029030846 7:97464954-97464976 AAGCCCTTACTCTTTCTCAAGGG - Intergenic
1032695070 7:134328538-134328560 TAGCGCATAATCTTTCTGAGAGG + Intergenic
1032797626 7:135290371-135290393 AACCCCAGACTCAGTCGGAGAGG + Intergenic
1032836536 7:135680491-135680513 AACACCAGCCTCTTTCTGAAAGG + Intronic
1034671433 7:152861886-152861908 TACCACATTCTCATTCTGAGTGG - Intergenic
1036504625 8:9344305-9344327 AGCCCCATACTCATAGTGAGAGG + Intergenic
1037593691 8:20335818-20335840 AACACGACAGTCTTTCTGAGTGG + Intergenic
1043467241 8:80523215-80523237 AAGCCCATACTCTTTCAGGGAGG + Exonic
1043493575 8:80775270-80775292 AAACCCATAATCTTTCTTACAGG - Intronic
1046118077 8:109808674-109808696 AAGCCCATTTTCATTCTGAGCGG + Intergenic
1048427954 8:134340031-134340053 AACTCACTTCTCTTTCTGAGAGG - Intergenic
1051477844 9:17528145-17528167 AACCCCCTACTCCTTATGTGTGG + Intergenic
1052433728 9:28399644-28399666 AACCCCATAGTATTTCACAGTGG - Intronic
1054974686 9:71128406-71128428 AACCCCATCCCCTTTGTGAATGG - Intronic
1062205318 9:135333292-135333314 CACCCCATAGTCCTGCTGAGAGG + Intergenic
1187070756 X:15885695-15885717 AAATCCATCCTCTTTTTGAGGGG + Intergenic
1187727884 X:22222768-22222790 ATCCCCATACTAGTCCTGAGAGG + Intronic
1189095525 X:38134632-38134654 AATACCATATTCTTCCTGAGAGG - Intronic
1191596881 X:62954853-62954875 AAACCTTTACTCTTTGTGAGAGG - Intergenic
1191831266 X:65419022-65419044 AAGCCCCTACTCTGTCTGAGGGG - Intronic
1192542474 X:71986379-71986401 AACCCCATACTCACTAAGAGAGG + Intergenic
1194615270 X:96093237-96093259 ATCCCCATACTGTTTTTCAGAGG - Intergenic
1196241507 X:113347642-113347664 AACCACATCCACTTTCTTAGTGG + Intergenic
1197255752 X:124261068-124261090 AAACCCCTACTCTTTCTGCAGGG - Intronic
1200012327 X:153128067-153128089 TACCCCATCTTCTCTCTGAGTGG + Intergenic
1200027273 X:153271852-153271874 TACCCCATCTTCTCTCTGAGTGG - Intergenic
1200302503 X:154991836-154991858 ATCACCATACTCTTTCTGAATGG - Intronic