ID: 1171422322

View in Genome Browser
Species Human (GRCh38)
Location 20:25025438-25025460
Sequence CAGAAAATGAACGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171422322_1171422324 11 Left 1171422322 20:25025438-25025460 CCAGCATCTGCGTTCATTTTCTG 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1171422324 20:25025472-25025494 ACAAATGACCACAAACTTAGTGG 0: 18
1: 219
2: 873
3: 2001
4: 3449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171422322 Original CRISPR CAGAAAATGAACGCAGATGC TGG (reversed) Intronic
902168812 1:14594436-14594458 CAGACAATGTACGTAGAGGCTGG + Intergenic
903001152 1:20266790-20266812 CAGAGAAAGAACACAGATGGAGG + Intergenic
903116126 1:21179370-21179392 CAGAAAATGAAAGGAGAATCTGG - Intergenic
904823890 1:33262249-33262271 CAGAAAAGGACCCCAGATGGTGG - Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908499956 1:64733271-64733293 CTGAAAATCATCTCAGATGCAGG + Intergenic
909713417 1:78678275-78678297 CAGAAAATGAAAGCAACTCCGGG + Intergenic
909779936 1:79531759-79531781 CAGAGACTGAAGGCAGAGGCAGG - Intergenic
910110485 1:83677598-83677620 TAGAAAATAAAAGCAGATGTAGG + Intergenic
911708887 1:101046195-101046217 CTGAAAATGGCCACAGATGCTGG + Intergenic
911936576 1:103982967-103982989 CAGACAGTGAATGCAGAAGCCGG + Intergenic
912428905 1:109618653-109618675 CAAAAAATAAACGCTAATGCAGG - Intronic
913339230 1:117741148-117741170 AATAAAATGAATGCAGATGCAGG - Intergenic
914802398 1:150971205-150971227 CAGAAAGTGAAAGCAGAGACAGG + Intronic
916440743 1:164822066-164822088 AAGAAAATTAACACAGAAGCTGG + Intronic
917306821 1:173634954-173634976 AAAAAAATAAAAGCAGATGCTGG + Intronic
917918216 1:179726021-179726043 GAGAAAATGAAGGGAAATGCAGG - Intergenic
918380209 1:183946163-183946185 CAGAAAATGAACTCTGAGTCAGG - Intronic
918917562 1:190664386-190664408 AAGGATATGAAGGCAGATGCAGG + Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
919087177 1:192934171-192934193 AAGAAAATGAAGACTGATGCAGG - Intergenic
921077447 1:211711496-211711518 TAGAAAATGAAAGCACATGTTGG - Intergenic
921937907 1:220811761-220811783 CAGAAAATTAAAGAAGACGCAGG - Intronic
923516080 1:234698958-234698980 AATAAAATGAAGGAAGATGCCGG + Intergenic
1062766963 10:73659-73681 CACAAAATGAGCGCTGATCCGGG + Intergenic
1063905805 10:10779001-10779023 CAGAAAAAGAACAAAGATGGGGG + Intergenic
1064618989 10:17194954-17194976 AAAAAAAAAAACGCAGATGCTGG + Intronic
1065280641 10:24134292-24134314 CAGAAAAACATAGCAGATGCAGG + Intronic
1069693264 10:70368573-70368595 CAGAAAAAAAATGCAGATTCAGG - Intronic
1070235477 10:74620693-74620715 GAGAAAAAAAAAGCAGATGCTGG - Intronic
1070393620 10:75992603-75992625 AAGAAAATGAGCCCTGATGCTGG + Intronic
1075415216 10:122257912-122257934 GAGAAAATGATTGCAGCTGCTGG + Intergenic
1075542452 10:123326403-123326425 CACAATATGAAAGCAGAGGCAGG - Intergenic
1078714491 11:13826929-13826951 CAGAAAATGACAGCAGAAACGGG + Intergenic
1079623192 11:22580932-22580954 CAGAAATTGATGGCAAATGCAGG + Intergenic
1080226097 11:29962331-29962353 CAGAAAATGGAAGCATAAGCGGG + Intergenic
1081498452 11:43640072-43640094 CAGAATATGCCCGCAAATGCTGG + Intronic
1082992206 11:59217010-59217032 CAGAGAAAGAAAGCAGATGTGGG - Intergenic
1085554205 11:77404645-77404667 GAGAAAATGGATGCAGATACAGG - Intronic
1087039944 11:93788825-93788847 CAGTTAATGAAGGCAGAGGCAGG - Intronic
1088375005 11:109131206-109131228 CAGAAAAGGGATGCAAATGCAGG + Intergenic
1089682657 11:120127943-120127965 CAGAAAATGAATGTGTATGCTGG + Intronic
1090727821 11:129543501-129543523 CAGAAGTTGAACCCTGATGCAGG - Intergenic
1092653095 12:10655492-10655514 CAGAAATTGAACGCTGAACCAGG - Intronic
1102331728 12:112038597-112038619 GAGAAAAACAACGCATATGCAGG + Intronic
1102591075 12:113957277-113957299 CAGAAAATAAATGCAGAGGCTGG + Intronic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1102685143 12:114718723-114718745 GGGAAATTGAACGCAGGTGCTGG - Intergenic
1103514945 12:121501425-121501447 AAGAAAATGAAGGCAGAGACTGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105370157 13:19795190-19795212 TAAAAAATGAATGCAGAGGCTGG + Intergenic
1106323824 13:28668787-28668809 AAAAACATGAAAGCAGATGCAGG - Intronic
1107623475 13:42258633-42258655 GAGAAAATGAAGGCAGAGGTTGG - Intergenic
1111101718 13:83596842-83596864 CAGAAAATTAACAGATATGCAGG - Intergenic
1111586425 13:90289312-90289334 CAGAGAAAGAAGGGAGATGCAGG + Intergenic
1112962124 13:105139525-105139547 GAGAAAACGAACGCACATGTTGG - Intergenic
1115108776 14:29795065-29795087 CAGAGAATGAAAACAAATGCTGG - Intronic
1115850595 14:37587414-37587436 CAGAAAATGAAAACAGAGGTTGG + Intergenic
1117226897 14:53670433-53670455 CAGACACTGGACACAGATGCTGG + Intergenic
1117516435 14:56506749-56506771 CAGGAAATGTAGGCAGAGGCGGG + Intronic
1119456691 14:74762074-74762096 CAGAAAAGAAACGCAGAGGCAGG - Intergenic
1119640854 14:76313860-76313882 CAGAAAATAAACTCAGATTGTGG + Intronic
1122112524 14:99512288-99512310 CAGAAAATAGACGTAGCTGCCGG + Exonic
1125809728 15:42527780-42527802 CAGAATAAGAAGGCTGATGCTGG - Intronic
1126366699 15:47902020-47902042 CACAAAATGAAAGCACAGGCAGG + Intergenic
1127523105 15:59762694-59762716 CACAAAATGAAAGCAAAGGCTGG - Intergenic
1129570720 15:76681567-76681589 CAGAAGCAGAATGCAGATGCTGG + Intronic
1130219639 15:82008454-82008476 TAGAATATGAAGGCAGAGGCTGG + Intergenic
1130670218 15:85905658-85905680 TTGAAAATGAACACAGAAGCCGG - Intergenic
1134589081 16:15437324-15437346 CAGAAAATGAAGGCAGAGTGAGG - Intronic
1135479136 16:22806795-22806817 AAGTATATGAACACAGATGCAGG + Intergenic
1135923399 16:26671460-26671482 TAGAAAATGAATGCAGATTTTGG - Intergenic
1136098450 16:27975425-27975447 AAGAAAAGCAACGCAGGTGCAGG - Intronic
1136112128 16:28070289-28070311 CAGAAAATGCTCTCAGAGGCAGG + Intergenic
1138115114 16:54354611-54354633 CACAAAATGAACGTACATACAGG + Intergenic
1141507049 16:84484665-84484687 CAAACAATGAAGGCAAATGCTGG - Intronic
1141932855 16:87217303-87217325 CAGAAAATGAGGGCCGATCCCGG + Intronic
1144160970 17:12557555-12557577 CATAAAATAAAGGTAGATGCTGG - Intergenic
1146313297 17:31787771-31787793 CAGGAAGTGAAGGCAGAGGCTGG + Intergenic
1147338131 17:39739111-39739133 CAGAGAATGAATGCATCTGCCGG + Intronic
1147733682 17:42620225-42620247 CAGATAATGAATGCATGTGCAGG - Intergenic
1150564692 17:66328499-66328521 TAGAAACTGAAGGCAGAGGCTGG + Intronic
1153759581 18:8317548-8317570 CAGAGAATGAGAGCAGATGGAGG + Intronic
1156918437 18:42489000-42489022 GAGGAAATGAACTCAGATGGTGG - Intergenic
1157117396 18:44874938-44874960 CAGAAAAGGAAGGCTGAAGCAGG + Intronic
1157294365 18:46431944-46431966 AAGAAAAAGAAAGCAGATGGAGG - Intronic
1157339063 18:46762998-46763020 CTGAAAAGGCACGGAGATGCCGG + Intergenic
1157400797 18:47384844-47384866 CAGAAAATGGATGCAGCTGGAGG - Intergenic
1161601898 19:5189209-5189231 CAGAAGATGAACGTAGATGGGGG - Intronic
1162738626 19:12760875-12760897 AAGAAAAAGAAAGCAGATGAGGG - Intergenic
1163912858 19:20213226-20213248 TAGAAAATGAATGCAGAGGCTGG + Intergenic
1164697731 19:30259354-30259376 CAGAAAAAGAATGCAGCAGCGGG + Intronic
1166663529 19:44662991-44663013 CAGAAAGTGGCTGCAGATGCTGG - Exonic
1167341304 19:48918160-48918182 CAGAAAGTCAAGTCAGATGCAGG + Intronic
925950699 2:8907587-8907609 CAGAAAAGGAGAGCAGATGCTGG - Intronic
926001222 2:9334350-9334372 AAGAAAAGGAATGCAGAGGCCGG - Intronic
926272915 2:11380066-11380088 CAGACCATGAATGGAGATGCTGG - Intergenic
926301641 2:11608989-11609011 CAGAAACTGTAGGCAGAAGCTGG + Intronic
926958701 2:18331093-18331115 TAGAAAATGAATGTAGATTCTGG + Intronic
930583413 2:53241417-53241439 AAGAAAATGAACCCAGAAGGAGG - Intergenic
931432711 2:62221354-62221376 GAGAAAATGAAAGCAGACTCAGG - Intronic
931920204 2:67007073-67007095 CAGAACATGAATGCAGGAGCTGG + Intergenic
933625046 2:84588559-84588581 TAGGAAATGAAAGCAGATGAGGG + Intronic
935202147 2:100866489-100866511 CAAAAAAGCAACGCAGATGTTGG + Intronic
935422128 2:102880176-102880198 CAGAAAATGAGCCTAGAAGCTGG - Intergenic
936886982 2:117322343-117322365 AAGAAAATGAATGCACATTCAGG - Intergenic
937272287 2:120660822-120660844 CAGAAACAGAACCCAGAGGCTGG + Intergenic
938282702 2:130076255-130076277 CAAAAAATATACACAGATGCAGG + Intronic
938333336 2:130464826-130464848 CAAAAAATATACACAGATGCAGG + Intronic
938356476 2:130655845-130655867 CAAAAAATATACACAGATGCAGG - Intronic
938432911 2:131262650-131262672 CAAAAAATATACACAGATGCAGG - Intronic
938476975 2:131625234-131625256 CAAAAAATATACACAGATGCAGG - Intergenic
940725592 2:157332307-157332329 ACGAAAATGAAGGCAGAGGCCGG - Intergenic
941345450 2:164362810-164362832 CAGAAAATTAAAGCAGAGACCGG - Intergenic
941738771 2:169010289-169010311 AAAAAAATGAAAGCAGATGAAGG - Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
943093697 2:183403841-183403863 GAGAAAATGAACCCTAATGCTGG - Intergenic
943878783 2:193110597-193110619 CACAAAATGAATGAAGATGCAGG + Intergenic
944022499 2:195123863-195123885 CAGAAAAGGAAGGGAGATGCAGG + Intergenic
947097378 2:226581437-226581459 CAGAACCTTAAGGCAGATGCTGG + Intergenic
947180254 2:227405086-227405108 CATAAAATGTACGTAGATGAAGG + Intergenic
948490051 2:238306882-238306904 CAGCAAAGGAAGACAGATGCTGG - Intergenic
948999835 2:241606984-241607006 GAGAAAATGAAAGGGGATGCAGG + Intronic
1169331220 20:4717796-4717818 CAGAAAATGAGCCCAGAGGGTGG - Intergenic
1169879266 20:10328860-10328882 GAGAAAATGAAAGCACTTGCCGG - Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1172957901 20:38774644-38774666 CAGACAATGAAAGCAAAAGCAGG - Intergenic
1176685344 21:9843609-9843631 CATAAAATGAACACAGATGTAGG - Intergenic
1178021910 21:28417996-28418018 CAGCAACTGAGCGCAGATGAAGG + Intergenic
1179956157 21:44740284-44740306 CACAAAATGATGACAGATGCAGG + Intergenic
1180031572 21:45212377-45212399 CAGAACATGCAGGCAGGTGCTGG + Intronic
1181878331 22:25957441-25957463 CAGAAATTGGAGACAGATGCAGG - Intronic
951077281 3:18410705-18410727 CAGTATATGAACACTGATGCTGG + Intronic
951336936 3:21434786-21434808 CAGAAAAAGATCTCAGATGCAGG + Intronic
951407507 3:22318312-22318334 GAGAAAATGGATGAAGATGCAGG + Intronic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
955609767 3:60744716-60744738 GAGAAAATGTATTCAGATGCAGG - Intronic
955893235 3:63672527-63672549 CTGAAAATGAAAACAGAAGCCGG + Intronic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
957532260 3:81455520-81455542 AAGAAAAGAAAAGCAGATGCTGG + Intergenic
959079889 3:101789062-101789084 CAGAAAATGAAATCAAAAGCTGG - Intronic
960428525 3:117539477-117539499 CAGAAATTGCAGCCAGATGCCGG - Intergenic
962231407 3:133668706-133668728 CATGCAATGAACACAGATGCTGG - Intergenic
962528323 3:136255495-136255517 CATAAAAAGAATGCAGAAGCAGG - Intronic
963059413 3:141212752-141212774 CAGACAGTGAAGGCAGGTGCTGG + Intergenic
963605287 3:147407759-147407781 CAAAAAATGCACGCGGATGCGGG - Intronic
967630405 3:191738238-191738260 CAGAGAATGGACTCAGAGGCAGG + Intergenic
970036225 4:11738634-11738656 CAGACCATGAAGGCAGCTGCAGG + Intergenic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
973150571 4:46882336-46882358 CAGAAAATTAACAAAGATTCAGG - Intronic
977056234 4:92195302-92195324 TAGAAAATGAACCCAGATACAGG + Intergenic
977593784 4:98855389-98855411 CAGAGAATGAAGGCAGTGGCTGG + Intergenic
977696121 4:99968575-99968597 CAGAAGATGGGTGCAGATGCAGG - Intergenic
980348798 4:131662078-131662100 CATAAAATGAACGGAGATGTAGG - Intergenic
982165921 4:152613696-152613718 GAGAAAATGAGCGCAGCAGCAGG - Intergenic
982461476 4:155674494-155674516 CATATAAAGAACGAAGATGCTGG - Intronic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
986712407 5:10497740-10497762 AAGACCATGAAGGCAGATGCAGG - Intergenic
991435043 5:66589360-66589382 CAGAAAATGAAAGGAAAAGCTGG + Intergenic
993574957 5:89589614-89589636 CATAAATAGAACTCAGATGCTGG - Intergenic
994903462 5:105805001-105805023 CAGAATATGAACTCAGATAAAGG - Intergenic
997276712 5:132599261-132599283 CTGAAAATGGACCAAGATGCTGG + Intronic
998622713 5:143812363-143812385 GAGAAAATGAAAGAAAATGCTGG + Intronic
999151498 5:149429249-149429271 CAGAAAGAGAAAGCAGAGGCAGG - Intergenic
1001018936 5:168166210-168166232 CAGAACATGAATGCAGACCCGGG + Intronic
1002455033 5:179341223-179341245 CAGAAAAGGAAAGAAGAGGCCGG + Intronic
1003300790 6:4880688-4880710 CAGAACATGACAGCAAATGCTGG - Intronic
1005492989 6:26363962-26363984 CAGAGAATGAAGTCAGAAGCAGG - Intergenic
1005502264 6:26439286-26439308 CAGAGAATGAAGTCAGAAGCAGG - Intergenic
1005794570 6:29345685-29345707 CAAAAAATGAACAAAGCTGCAGG + Intergenic
1006218210 6:32464603-32464625 AAGAAAATGAACAAAGAAGCTGG - Intergenic
1007182426 6:39939287-39939309 CAGAGAGGGAACGCACATGCTGG + Intergenic
1013373777 6:109494442-109494464 CTGAGAATGAAAGCAGATACGGG - Intronic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015350705 6:132215075-132215097 CAGATAATGGGAGCAGATGCTGG - Intergenic
1018232505 6:161689231-161689253 CACAAAGTGAACCCAGATCCCGG + Intronic
1020003113 7:4766721-4766743 CAGAAAATGGACCCAGGAGCCGG - Exonic
1020964738 7:14850872-14850894 CAGAAACTGAATGAGGATGCAGG - Intronic
1021171206 7:17399847-17399869 AAGAAAATGAACGAATATGTGGG - Intergenic
1021739052 7:23667197-23667219 AAGAAAAAGAACGCAGATTAAGG - Intergenic
1024944021 7:54790972-54790994 CAGAAAATGAAAGGAGATTCAGG - Intergenic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1027659264 7:80969663-80969685 CAGAAATTGTTCCCAGATGCTGG + Intergenic
1027918861 7:84363948-84363970 CACAGATTGAAAGCAGATGCAGG + Intronic
1028735661 7:94209437-94209459 AAGAAAAGGAAAACAGATGCAGG + Intergenic
1028822313 7:95226703-95226725 CAGAAAAGGAAAGCAGAGTCAGG - Intronic
1029092278 7:98057549-98057571 AAGAAAATGAAGGCAGGTGATGG + Intergenic
1030417643 7:109265402-109265424 CAGACAATGAATGTAGATGATGG + Intergenic
1030590373 7:111474018-111474040 AACAACATGAACGCAGATGGAGG + Intronic
1032462205 7:132120375-132120397 GAGTAAATGGAGGCAGATGCAGG - Intergenic
1034850612 7:154489927-154489949 AAGAAAATGAATGCACATGTCGG - Intronic
1035116450 7:156528499-156528521 CAGAAAATGATCCCCCATGCTGG - Intergenic
1036495715 8:9268366-9268388 GAGAAAAAGAAAGCAGATGAGGG + Intergenic
1037545965 8:19922774-19922796 CAGAGAAAGAAAGCAGAGGCCGG + Intronic
1037795264 8:21988198-21988220 CAGAAAGTGAATGCCTATGCTGG - Intronic
1045760725 8:105603752-105603774 AAGAAAATGAAAGCAGGTGGGGG + Intronic
1046863870 8:119124375-119124397 CAGCAAATGAAGGCTGATGGAGG + Intergenic
1046892784 8:119441347-119441369 CAGAAAATAAGCACAGATTCAGG - Intergenic
1050038966 9:1467575-1467597 CAGAAAATAAAAGCAGACCCAGG + Intergenic
1050873696 9:10609921-10609943 CAGCAACTGAAAGCAAATGCAGG + Intronic
1050947677 9:11546993-11547015 CTGAAAATGGAAGCAGTTGCTGG - Intergenic
1051104998 9:13569364-13569386 CCAAAAATGAAAGCAGGTGCAGG - Intergenic
1051319907 9:15891789-15891811 CAGAGAATGAACGAGCATGCAGG + Intronic
1054171919 9:61848138-61848160 CATAAAATGAACAGAGATGTAGG + Intergenic
1054446780 9:65377150-65377172 CATAAAATGAACAGAGATGTAGG + Intergenic
1054665616 9:67732674-67732696 CATAAAATGAACAGAGATGTAGG - Intergenic
1058451417 9:105099959-105099981 CATAAACTGAACTTAGATGCAGG - Intergenic
1058750397 9:108033609-108033631 AAGAAACTGAAAGCAGATGCAGG - Intergenic
1059361128 9:113742777-113742799 CAGAAACTGAACCCAGAGGAAGG - Intergenic
1061955603 9:133959793-133959815 GAGAAGATGAAGGCAGAGGCTGG + Intronic
1185523455 X:759151-759173 CAGGACATGACCGCAGAGGCAGG + Intergenic
1186967227 X:14801191-14801213 CAGAACATGAACTCAGAGACTGG - Intergenic
1187783308 X:22854519-22854541 CAGAAAATGGACTAAGATACAGG - Intergenic
1189350686 X:40273442-40273464 CAGAAAACAAGCGCAGCTGCAGG + Intergenic
1189944069 X:46159083-46159105 CAGAATATGGACACAGATCCTGG + Intergenic
1191832818 X:65433110-65433132 CAGCAAATGAACACATATCCTGG - Intronic
1195324990 X:103751230-103751252 CAGAATATGAACACAAAGGCAGG + Intergenic
1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG + Intergenic
1201326588 Y:12766973-12766995 GAGAAAATGTACGCAGACACAGG + Intronic