ID: 1171427943

View in Genome Browser
Species Human (GRCh38)
Location 20:25060118-25060140
Sequence GGTTCCATGGGAGGATAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171427943_1171427955 22 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427955 20:25060163-25060185 GGGGCTGGCCTTCCAGAGGAAGG No data
1171427943_1171427951 2 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427951 20:25060143-25060165 GCTGCGAGCTGTGAGGAAGCGGG No data
1171427943_1171427953 7 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427953 20:25060148-25060170 GAGCTGTGAGGAAGCGGGGCTGG No data
1171427943_1171427954 18 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427954 20:25060159-25060181 AAGCGGGGCTGGCCTTCCAGAGG No data
1171427943_1171427956 23 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427956 20:25060164-25060186 GGGCTGGCCTTCCAGAGGAAGGG No data
1171427943_1171427947 -5 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427947 20:25060136-25060158 GAACCCAGCTGCGAGCTGTGAGG No data
1171427943_1171427958 30 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427958 20:25060171-25060193 CCTTCCAGAGGAAGGGACCCAGG No data
1171427943_1171427952 3 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427952 20:25060144-25060166 CTGCGAGCTGTGAGGAAGCGGGG No data
1171427943_1171427950 1 Left 1171427943 20:25060118-25060140 CCAGCTTATCCTCCCATGGAACC No data
Right 1171427950 20:25060142-25060164 AGCTGCGAGCTGTGAGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171427943 Original CRISPR GGTTCCATGGGAGGATAAGC TGG (reversed) Intergenic
No off target data available for this crispr