ID: 1171428609

View in Genome Browser
Species Human (GRCh38)
Location 20:25064427-25064449
Sequence AACAGAGGGCAGAAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171428609_1171428615 4 Left 1171428609 20:25064427-25064449 CCTCCTGGCTTCTGCCCTCTGTT No data
Right 1171428615 20:25064454-25064476 CTCCAACCTGCCATGTGGCAAGG No data
1171428609_1171428613 -1 Left 1171428609 20:25064427-25064449 CCTCCTGGCTTCTGCCCTCTGTT No data
Right 1171428613 20:25064449-25064471 TCTGCCTCCAACCTGCCATGTGG No data
1171428609_1171428619 21 Left 1171428609 20:25064427-25064449 CCTCCTGGCTTCTGCCCTCTGTT No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171428609 Original CRISPR AACAGAGGGCAGAAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr