ID: 1171428611

View in Genome Browser
Species Human (GRCh38)
Location 20:25064441-25064463
Sequence CAGGTTGGAGGCAGAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171428611_1171428619 7 Left 1171428611 20:25064441-25064463 CCCTCTGTTCTGCCTCCAACCTG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428611_1171428615 -10 Left 1171428611 20:25064441-25064463 CCCTCTGTTCTGCCTCCAACCTG No data
Right 1171428615 20:25064454-25064476 CTCCAACCTGCCATGTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171428611 Original CRISPR CAGGTTGGAGGCAGAACAGA GGG (reversed) Intergenic
No off target data available for this crispr