ID: 1171428614

View in Genome Browser
Species Human (GRCh38)
Location 20:25064453-25064475
Sequence CTTGCCACATGGCAGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171428614_1171428619 -5 Left 1171428614 20:25064453-25064475 CCTCCAACCTGCCATGTGGCAAG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171428614 Original CRISPR CTTGCCACATGGCAGGTTGG AGG (reversed) Intergenic
No off target data available for this crispr