ID: 1171428619

View in Genome Browser
Species Human (GRCh38)
Location 20:25064471-25064493
Sequence GCAAGGCCCCTGACATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171428606_1171428619 30 Left 1171428606 20:25064418-25064440 CCTAGAACCCCTCCTGGCTTCTG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428609_1171428619 21 Left 1171428609 20:25064427-25064449 CCTCCTGGCTTCTGCCCTCTGTT No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428616_1171428619 -8 Left 1171428616 20:25064456-25064478 CCAACCTGCCATGTGGCAAGGCC No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428611_1171428619 7 Left 1171428611 20:25064441-25064463 CCCTCTGTTCTGCCTCCAACCTG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428608_1171428619 22 Left 1171428608 20:25064426-25064448 CCCTCCTGGCTTCTGCCCTCTGT No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428610_1171428619 18 Left 1171428610 20:25064430-25064452 CCTGGCTTCTGCCCTCTGTTCTG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428612_1171428619 6 Left 1171428612 20:25064442-25064464 CCTCTGTTCTGCCTCCAACCTGC No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428614_1171428619 -5 Left 1171428614 20:25064453-25064475 CCTCCAACCTGCCATGTGGCAAG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data
1171428607_1171428619 23 Left 1171428607 20:25064425-25064447 CCCCTCCTGGCTTCTGCCCTCTG No data
Right 1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171428619 Original CRISPR GCAAGGCCCCTGACATCTCT AGG Intergenic
No off target data available for this crispr