ID: 1171430179

View in Genome Browser
Species Human (GRCh38)
Location 20:25078057-25078079
Sequence CGTGAGTCCGGACCGCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171430179_1171430184 -5 Left 1171430179 20:25078057-25078079 CCCACGTGCGGTCCGGACTCACG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1171430184 20:25078075-25078097 TCACGGGCATTCAACGCAGTAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1171430179_1171430185 -4 Left 1171430179 20:25078057-25078079 CCCACGTGCGGTCCGGACTCACG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1171430185 20:25078076-25078098 CACGGGCATTCAACGCAGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171430179 Original CRISPR CGTGAGTCCGGACCGCACGT GGG (reversed) Intronic
902169567 1:14599068-14599090 CGTGAGTTCGGCTCGCAGGTTGG - Exonic
1076574305 10:131453717-131453739 CGGGAGTCCGGGCAGCACGGCGG - Intergenic
1128495744 15:68197471-68197493 CGTGAGTTTTGACCGCAGGTCGG + Exonic
1133061941 16:3180557-3180579 CGTGGGTTCGAGCCGCACGTTGG - Intergenic
1167356901 19:49010062-49010084 CGGGAGTCCCGGCCGCACCTGGG - Exonic
948199511 2:236119672-236119694 CGAGAGCACGGACCGCACGATGG - Intronic
1171347700 20:24478425-24478447 AGTGAGGCTGGACGGCACGTTGG - Intronic
1171430179 20:25078057-25078079 CGTGAGTCCGGACCGCACGTGGG - Intronic
984928199 4:184825459-184825481 CGGGCGTTCGGACCGCGCGTGGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
1040980476 8:53241770-53241792 CTGGAGTCCTGATCGCACGTGGG - Intronic