ID: 1171430559

View in Genome Browser
Species Human (GRCh38)
Location 20:25081263-25081285
Sequence GGTACCTTGTTCGGTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171430549_1171430559 23 Left 1171430549 20:25081217-25081239 CCAGGACCCGTCAATCATTCGAT 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1171430555_1171430559 -9 Left 1171430555 20:25081249-25081271 CCGCGTTTCCACCTGGTACCTTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1171430553_1171430559 -5 Left 1171430553 20:25081245-25081267 CCGCCCGCGTTTCCACCTGGTAC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1171430550_1171430559 17 Left 1171430550 20:25081223-25081245 CCCGTCAATCATTCGATCATTTC 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1171430554_1171430559 -8 Left 1171430554 20:25081248-25081270 CCCGCGTTTCCACCTGGTACCTT 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1171430551_1171430559 16 Left 1171430551 20:25081224-25081246 CCGTCAATCATTCGATCATTTCC No data
Right 1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171430559 Original CRISPR GGTACCTTGTTCGGTGCTGC TGG Intronic
904364020 1:29999202-29999224 GGTACTTCGGTGGGTGCTGCAGG + Intergenic
911352179 1:96766554-96766576 GGACCCTTTTTCGGTGTTGCTGG + Intronic
914400511 1:147316134-147316156 GATACCTTGGTTGGTGGTGCAGG - Intergenic
915901510 1:159850008-159850030 GAAACCTTGTTCAGTGCTGGAGG - Intronic
919438054 1:197588122-197588144 GGTACTGGGTTGGGTGCTGCAGG - Intronic
923219593 1:231881153-231881175 GATACCTTGTTCTCTGCTGCAGG + Intronic
923615208 1:235531550-235531572 GGCACCTTGGTGGGTGATGCTGG - Intergenic
1068135076 10:52944388-52944410 GCTGCATTGTTCTGTGCTGCAGG + Intergenic
1072290767 10:93962249-93962271 GGTACAGTGTAAGGTGCTGCAGG - Intergenic
1073433146 10:103499860-103499882 GGTCCCTCCTTCGATGCTGCCGG + Intronic
1080585924 11:33682686-33682708 GGAAACAAGTTCGGTGCTGCTGG - Intergenic
1086454883 11:86951530-86951552 GGAACTTTGTTCATTGCTGCAGG - Exonic
1089644156 11:119867016-119867038 GGTACCTTGATAGATGTTGCTGG - Intergenic
1091323101 11:134665380-134665402 TGTATCCTGTTCGGTGGTGCTGG + Intergenic
1091550871 12:1534028-1534050 GGAACCTGGTTCGGTACTGGGGG + Intronic
1092559968 12:9602030-9602052 AGTACCATGTTAGGTGCTGGTGG + Intronic
1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1102646224 12:114405623-114405645 GTTACCTCGTTCGGTGAAGCCGG + Intronic
1104682677 12:130762188-130762210 GGTTCCCTGTTCGCTGGTGCGGG + Intergenic
1120700944 14:87698192-87698214 GGTACCTTCTTCAGTGCTTCTGG - Intergenic
1121520828 14:94585224-94585246 TGTACCTTTTTGGGTGGTGCAGG + Intronic
1126483726 15:49155811-49155833 GGGACATCGTCCGGTGCTGCAGG + Intronic
1130748894 15:86688153-86688175 GGCACATTGCTTGGTGCTGCAGG + Intronic
1132371542 15:101302836-101302858 AGTAACTTGTTAAGTGCTGCTGG - Intronic
1135728012 16:24872108-24872130 GGTACCTTGTTGTGAGCTGGGGG + Intronic
1142323916 16:89401951-89401973 GGTTCCTTCTGCGGTGCTGGAGG - Intronic
1154125536 18:11689420-11689442 CGGACCCTGTTCGGCGCTGCCGG - Exonic
1158826872 18:61231336-61231358 GGTACCATGCTAGGTGCTGGTGG - Intergenic
1159725361 18:71951262-71951284 GGCCCCGTGTTCGGTGCTGATGG + Intergenic
1160311406 18:77794459-77794481 GGTACCCTGCTAGGTGCTGGAGG + Intergenic
1161938182 19:7385077-7385099 GGCACCTTGTTCTCTTCTGCAGG + Intronic
1168665673 19:58203214-58203236 GGCACTTAGTCCGGTGCTGCTGG + Intronic
926748579 2:16180442-16180464 GGTACCTTCTTCAGCCCTGCAGG + Intergenic
940165625 2:150767468-150767490 GGTACCTGCTTCTGTGCTGTGGG - Intergenic
940278972 2:151970081-151970103 GGTATATTGTACGGTGATGCCGG - Intronic
941185081 2:162312360-162312382 GGTACCTATTTCTGGGCTGCTGG - Intronic
946093944 2:217255927-217255949 GGTACCAGGTTCCGTGCTGAGGG - Intergenic
946978942 2:225185371-225185393 GGTAGAGTGTTTGGTGCTGCTGG + Intergenic
948963903 2:241361460-241361482 GGTAGCTTGGGAGGTGCTGCTGG - Intronic
1169217575 20:3802380-3802402 GGTACCCCCTTCGCTGCTGCAGG - Intronic
1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG + Intronic
1172356459 20:34283705-34283727 CATACCTTGTTCTGTGCAGCTGG - Intronic
1179816535 21:43909784-43909806 GGGACTTTGTTCTCTGCTGCAGG + Intronic
1184205250 22:42998267-42998289 GGAACCTTCTTTGCTGCTGCAGG + Intronic
955097310 3:55812225-55812247 GGTACCTTGCTAGCTGCTGAAGG - Intronic
960356639 3:116661976-116661998 GATACATTGTACAGTGCTGCTGG - Intronic
961376534 3:126469775-126469797 GGTAACATGTAGGGTGCTGCAGG - Intronic
963902162 3:150743230-150743252 GGTTCCTTGCTCTTTGCTGCTGG + Intronic
965977276 3:174640943-174640965 GCTACCTTCCTCGGTGCTTCCGG - Intronic
972437499 4:39047663-39047685 GGCACCTTCTTCTGTGCTTCAGG + Intronic
986022055 5:3813355-3813377 TGTGCATTGTTCAGTGCTGCAGG + Intergenic
989241022 5:39202797-39202819 GGTACATTGCTGGGTCCTGCAGG + Exonic
994178068 5:96733905-96733927 GGTACCATGGTTGGTTCTGCAGG + Intronic
1001334880 5:170788789-170788811 GTTTCATTGTTCGGTGCTCCAGG - Intronic
1012130141 6:95480763-95480785 GGTTCCTTGTTCTGTTCTGTTGG + Intergenic
1019538074 7:1539084-1539106 GGCACCCTGTCCGGCGCTGCCGG + Intronic
1019731345 7:2631345-2631367 GGTGCCTTGCTGGGCGCTGCGGG + Intergenic
1024480295 7:49855611-49855633 GGTTTCTTGATCTGTGCTGCAGG + Intronic
1028487501 7:91376018-91376040 GGCACCATGTTGGGTGCTGAAGG + Intergenic
1038482674 8:27912620-27912642 GGTACCTAGATCTCTGCTGCTGG + Intronic
1048285895 8:133141683-133141705 GGCCCCTTGTTTGGTGCTGAAGG + Intergenic
1048397188 8:134024904-134024926 GGTACCATGATAGGTGCTGAAGG + Intergenic
1059671087 9:116493248-116493270 GGTACCTTGTTAGGGGCTTATGG + Intronic
1061991012 9:134158834-134158856 GGTTCATTGTTCAGTGTTGCTGG + Exonic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1192140996 X:68647301-68647323 CACACCTTGTTCGGTCCTGCTGG + Intergenic
1197327158 X:125108153-125108175 GGTAACTTGTTTGGTGTTGAAGG - Intergenic
1199316787 X:146388111-146388133 GTTACCTTGTAGGGTGCTTCGGG - Intergenic