ID: 1171433855

View in Genome Browser
Species Human (GRCh38)
Location 20:25104302-25104324
Sequence GTGGTGGAAAGGACAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171433855_1171433860 -6 Left 1171433855 20:25104302-25104324 CCCTCCTCTGTCCTTTCCACCAC No data
Right 1171433860 20:25104319-25104341 CACCACACACAGCTTTCCTGAGG No data
1171433855_1171433864 10 Left 1171433855 20:25104302-25104324 CCCTCCTCTGTCCTTTCCACCAC No data
Right 1171433864 20:25104335-25104357 CCTGAGGTCCTTCGACTTCTGGG No data
1171433855_1171433862 9 Left 1171433855 20:25104302-25104324 CCCTCCTCTGTCCTTTCCACCAC No data
Right 1171433862 20:25104334-25104356 TCCTGAGGTCCTTCGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171433855 Original CRISPR GTGGTGGAAAGGACAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr