ID: 1171435370

View in Genome Browser
Species Human (GRCh38)
Location 20:25118043-25118065
Sequence CAGGGAAAGCAGGATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171435357_1171435370 21 Left 1171435357 20:25117999-25118021 CCACAGAAACCCAGAAAGGCTCA No data
Right 1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG No data
1171435361_1171435370 11 Left 1171435361 20:25118009-25118031 CCAGAAAGGCTCAGGAATTGGAC No data
Right 1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG No data
1171435360_1171435370 12 Left 1171435360 20:25118008-25118030 CCCAGAAAGGCTCAGGAATTGGA No data
Right 1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171435370 Original CRISPR CAGGGAAAGCAGGATGAGGC TGG Intergenic
No off target data available for this crispr