ID: 1171436116

View in Genome Browser
Species Human (GRCh38)
Location 20:25125919-25125941
Sequence AGTCATCTGAGGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171436116_1171436121 15 Left 1171436116 20:25125919-25125941 CCTGCCATCTTCCTCAGATGACT No data
Right 1171436121 20:25125957-25125979 AGCAGCTCTTGGCCTGCCACTGG No data
1171436116_1171436124 28 Left 1171436116 20:25125919-25125941 CCTGCCATCTTCCTCAGATGACT No data
Right 1171436124 20:25125970-25125992 CTGCCACTGGGCCTTAGTACAGG No data
1171436116_1171436122 16 Left 1171436116 20:25125919-25125941 CCTGCCATCTTCCTCAGATGACT No data
Right 1171436122 20:25125958-25125980 GCAGCTCTTGGCCTGCCACTGGG No data
1171436116_1171436119 -8 Left 1171436116 20:25125919-25125941 CCTGCCATCTTCCTCAGATGACT No data
Right 1171436119 20:25125934-25125956 AGATGACTACTCTCACTTTGAGG No data
1171436116_1171436120 4 Left 1171436116 20:25125919-25125941 CCTGCCATCTTCCTCAGATGACT No data
Right 1171436120 20:25125946-25125968 TCACTTTGAGGAGCAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171436116 Original CRISPR AGTCATCTGAGGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr