ID: 1171436550

View in Genome Browser
Species Human (GRCh38)
Location 20:25129524-25129546
Sequence TCTTCTCCCGACCACAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171436547_1171436550 15 Left 1171436547 20:25129486-25129508 CCTCCTGTGTAGAAGTGAACTTG No data
Right 1171436550 20:25129524-25129546 TCTTCTCCCGACCACAAGTGAGG No data
1171436548_1171436550 12 Left 1171436548 20:25129489-25129511 CCTGTGTAGAAGTGAACTTGAAT No data
Right 1171436550 20:25129524-25129546 TCTTCTCCCGACCACAAGTGAGG No data
1171436546_1171436550 16 Left 1171436546 20:25129485-25129507 CCCTCCTGTGTAGAAGTGAACTT No data
Right 1171436550 20:25129524-25129546 TCTTCTCCCGACCACAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171436550 Original CRISPR TCTTCTCCCGACCACAAGTG AGG Intergenic
No off target data available for this crispr