ID: 1171439355

View in Genome Browser
Species Human (GRCh38)
Location 20:25148227-25148249
Sequence GATGCGGGAGAGTCCACTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171439346_1171439355 0 Left 1171439346 20:25148204-25148226 CCGAGAGTGCTGACGTCCCCCTG 0: 1
1: 0
2: 0
3: 4
4: 153
Right 1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1171439339_1171439355 28 Left 1171439339 20:25148176-25148198 CCTCAGTGAGTGTGTCCCCATGG 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1171439343_1171439355 13 Left 1171439343 20:25148191-25148213 CCCCATGGGGAAGCCGAGAGTGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1171439345_1171439355 11 Left 1171439345 20:25148193-25148215 CCATGGGGAAGCCGAGAGTGCTG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1171439344_1171439355 12 Left 1171439344 20:25148192-25148214 CCCATGGGGAAGCCGAGAGTGCT 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171439355 Original CRISPR GATGCGGGAGAGTCCACTCC GGG Intergenic
900134789 1:1111713-1111735 GAGGCGGGAGGGTCCACTGGCGG + Intronic
901631857 1:10651937-10651959 GATGGGGCAGGGCCCACTCCAGG - Intronic
901663823 1:10815341-10815363 GAGGCGGGAGTGTGAACTCCTGG + Intergenic
905481494 1:38265044-38265066 GATGTGGGAGACTCCTCTCCAGG + Intergenic
907831339 1:58067023-58067045 GATGAGGGAGAAAACACTCCAGG - Intronic
910970198 1:92848481-92848503 GATCTGGGAGAGTACATTCCAGG - Intronic
912775897 1:112506411-112506433 CATGTGGGCGAGTCCACTCTAGG + Intronic
917977323 1:180248546-180248568 GAGGGTGGAGAGTCCACTCTGGG + Intronic
919920315 1:202163308-202163330 GGTGGGACAGAGTCCACTCCAGG + Intergenic
920640878 1:207751439-207751461 GATTCGGAAGGGTCCCCTCCAGG + Intergenic
922781345 1:228255489-228255511 CATGCGCGAGAGTCAGCTCCTGG + Intronic
1064146761 10:12832142-12832164 GCTGAGGGAAAGGCCACTCCAGG - Exonic
1072680956 10:97506173-97506195 GCTGGGGGAGAGCCCACTCCGGG + Intronic
1076600447 10:131653764-131653786 GAGGCGGGAGAGTCCCCGCTGGG + Intergenic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1082063647 11:47881450-47881472 GATGAGAGAGAGGCCACTCCCGG - Intergenic
1089566503 11:119374597-119374619 GATGCGGGGGAGGTAACTCCAGG - Intronic
1091396937 12:159271-159293 GGTGCGGGAGAGTCATCTTCCGG + Intronic
1092247953 12:6873638-6873660 GCTGCGGCAGAGTCCGCACCCGG + Intronic
1094569831 12:31631998-31632020 GGTTCGGGAAAGGCCACTCCTGG + Intergenic
1113616784 13:111685852-111685874 CCGGCGGGTGAGTCCACTCCAGG - Intergenic
1113622314 13:111771123-111771145 CCGGCGGGTGAGTCCACTCCAGG - Intergenic
1115892229 14:38044099-38044121 GCTGCTGGAGAGTCCCCTCCAGG - Intergenic
1118350806 14:64971734-64971756 GAGGCGGGAGACCCCACCCCTGG + Intronic
1119751463 14:77080910-77080932 GAGGCACGAGAATCCACTCCAGG + Intergenic
1121756642 14:96408323-96408345 GATGGGGCAGAGTCCAATCCAGG - Intronic
1122827658 14:104378594-104378616 GATGCTGGAGACCCCCCTCCAGG + Intergenic
1132862385 16:2078016-2078038 GTTGGGGGAGACACCACTCCTGG + Intronic
1133011089 16:2912194-2912216 GCTGCGGGCGCGTCCACGCCGGG - Intronic
1137996529 16:53220868-53220890 GAAGCGGCAGAGTACATTCCAGG - Intronic
1145199649 17:20931868-20931890 GAGGCTGGGGAGTCCACCCCAGG + Intergenic
1152604599 17:81282831-81282853 GAGGCGGGGGTGTCCTCTCCAGG - Intronic
1155313934 18:24552451-24552473 GATAGGGCAGAGTCCACTCTAGG + Intergenic
1157172284 18:45418896-45418918 GAGGGGAGAGGGTCCACTCCTGG + Intronic
1160139806 18:76311401-76311423 GATGCGGGTGACTGCACTCAGGG + Intergenic
1160580673 18:79883161-79883183 GACGCGGGAGAGGCCAGGCCAGG + Intronic
1160949429 19:1658398-1658420 GAAACGGGGGAGGCCACTCCAGG + Intergenic
1166217674 19:41346381-41346403 GGGGCTGGATAGTCCACTCCAGG + Intronic
1166546044 19:43635455-43635477 GAGGCGGGGGATTCCACTGCAGG - Intronic
1167359986 19:49024792-49024814 GATGCTGGAGAGTTCAGCCCTGG - Intronic
1167361098 19:49030979-49031001 GATGCTGGAGAGTTCAGCCCTGG + Intronic
1167362554 19:49037818-49037840 GATGCTGGAGAGTTCAGCCCTGG - Intergenic
1167574060 19:50309318-50309340 GTTGCGGGAGAGCCAAATCCAGG + Intronic
935790343 2:106584676-106584698 GCTGCGCGAGAGCCCACTGCGGG - Intergenic
938138008 2:128774979-128775001 GAGGTGGGAGAGACCCCTCCGGG + Intergenic
942459246 2:176158263-176158285 GATGGGGGAGAGGCCAGTGCGGG + Intronic
942770053 2:179505769-179505791 GATGTGGGACAGTTCACTTCAGG + Intronic
947166030 2:227263330-227263352 GATGGGGGATAGTCATCTCCTGG - Intronic
948753198 2:240144247-240144269 GAGGCTGGAGAGTCCAAGCCTGG + Intronic
1171401442 20:24875165-24875187 GGTGAGGGAGAGTCCTCGCCTGG - Intergenic
1171439355 20:25148227-25148249 GATGCGGGAGAGTCCACTCCGGG + Intergenic
1172992898 20:39049262-39049284 GATGCTGGAGAGGCTACTCATGG + Intergenic
1175955675 20:62607910-62607932 GAGGCGGGCGAGTCCATGCCTGG + Intergenic
1178517739 21:33263140-33263162 GAGGAGAAAGAGTCCACTCCAGG + Exonic
1181189793 22:21129935-21129957 GATGCGTGAGCCTCCACGCCTGG - Intergenic
1181209411 22:21280570-21280592 GATGCGTGAGCCTCCACGCCTGG + Intergenic
1181554764 22:23662551-23662573 GAGGCTGGACAGGCCACTCCTGG - Intergenic
1181708059 22:24661062-24661084 GATGCGTGAGCCTCCACGCCTGG - Intergenic
1182277169 22:29197282-29197304 GATGCGGGGGTGTCCACTCATGG - Intergenic
1183002804 22:34875746-34875768 GAAGCAGGAGAGTCCACTTCGGG - Intergenic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1184653273 22:45928918-45928940 GATGCGGGCAAGAGCACTCCAGG - Intronic
1185087597 22:48749188-48749210 TCTGAGGGAGGGTCCACTCCAGG - Intronic
1203217536 22_KI270731v1_random:14873-14895 GATGCGTGAGCCTCCACGCCTGG - Intergenic
958603692 3:96331528-96331550 GGTGAGGGAGAGCCCTCTCCTGG - Intergenic
961049781 3:123736612-123736634 GATGCTGGAAAGTCCAGTCTGGG + Intronic
966078030 3:175962971-175962993 GATGGGAGACAGTCCAATCCTGG + Intergenic
966305555 3:178530080-178530102 GATGCTGCAGAGCCCACTCTTGG - Intronic
978130184 4:105186566-105186588 GAGGCGGGAGAATCGCCTCCAGG - Intronic
998129729 5:139645623-139645645 GATCCAGGAGAGCACACTCCAGG + Intergenic
1001585008 5:172827955-172827977 GATGAGGGTGACTCCACCCCAGG + Intergenic
1003747779 6:9022495-9022517 GATGTGGGAAGGTCCACGCCAGG - Intergenic
1007967234 6:46014580-46014602 GCTGCGGGAGAGTAGCCTCCAGG - Intronic
1011611985 6:89161365-89161387 GTTACGGGAGACTCCATTCCAGG - Intronic
1012866323 6:104622608-104622630 GGTGCAGGAGAGGCCAATCCAGG + Intergenic
1022792314 7:33701372-33701394 GCTGTGGGAGAGTCCACACAGGG + Intergenic
1023494943 7:40785193-40785215 GCTGCTGGATTGTCCACTCCTGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1034395515 7:150821403-150821425 GAGGGAGGAGAGGCCACTCCTGG - Intergenic
1039079481 8:33721457-33721479 AATGAGGGAGAGTCCTCCCCGGG + Intergenic
1044957716 8:97498715-97498737 GATGTGGAAGAGTCCACTGGAGG - Intergenic
1048822277 8:138391322-138391344 GATAGGGGAGAGGCCAGTCCTGG - Intronic
1049631100 8:143658072-143658094 GGTGCTGGAGAGTCCCCACCAGG - Intergenic
1053269449 9:36740091-36740113 TATGCGGGAGAGTCACCACCAGG - Intergenic
1061822252 9:133235204-133235226 GATGCCGGCGACTCCCCTCCTGG - Intergenic
1189252824 X:39614296-39614318 GAGGAGGGAAAGTCCAGTCCCGG + Intergenic
1190265013 X:48823058-48823080 TTTGGGGAAGAGTCCACTCCAGG + Exonic
1190278947 X:48917252-48917274 GATGAGGTAGAGCCCTCTCCTGG + Intronic
1191101061 X:56729268-56729290 GATGGCGGCGAGTCCCCTCCAGG - Intergenic