ID: 1171442156

View in Genome Browser
Species Human (GRCh38)
Location 20:25173829-25173851
Sequence TGGAACTCCTTGAGAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171442156_1171442159 1 Left 1171442156 20:25173829-25173851 CCTATTTTTCTCAAGGAGTTCCA No data
Right 1171442159 20:25173853-25173875 GCTGTTAGAGCTTTAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171442156 Original CRISPR TGGAACTCCTTGAGAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr