ID: 1171444729

View in Genome Browser
Species Human (GRCh38)
Location 20:25195607-25195629
Sequence GGACCCAGTTGCGCAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171444729_1171444744 19 Left 1171444729 20:25195607-25195629 CCCGCGCCTGCGCAACTGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1171444744 20:25195649-25195671 CCCGCCTGCGCATGCGCGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 96
1171444729_1171444742 15 Left 1171444729 20:25195607-25195629 CCCGCGCCTGCGCAACTGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1171444742 20:25195645-25195667 CTCTCCCGCCTGCGCATGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 84
1171444729_1171444746 20 Left 1171444729 20:25195607-25195629 CCCGCGCCTGCGCAACTGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1171444746 20:25195650-25195672 CCGCCTGCGCATGCGCGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171444729 Original CRISPR GGACCCAGTTGCGCAGGCGC GGG (reversed) Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
902148707 1:14425153-14425175 GAACCCAGCTGGGCAGGGGCTGG + Intergenic
905789931 1:40784333-40784355 AGACCCAGTTCTGCAGGCGGCGG - Exonic
907509258 1:54946205-54946227 GGACCCACTGGGGCAGGCACGGG - Intergenic
916384310 1:164250024-164250046 GCACACAGTTGGGCAGGTGCAGG - Intergenic
923506169 1:234608689-234608711 GGGCCCCGGTGCGCAGGCGGCGG + Exonic
923957899 1:239043147-239043169 GAACCCAGATGGGCAGGTGCAGG - Intergenic
1065435855 10:25703160-25703182 GGACCCAGTTGGGCTGGGCCTGG + Intergenic
1073559049 10:104481511-104481533 GGACCCAGTTTCGCCTGAGCAGG + Intergenic
1077283295 11:1755006-1755028 GGACCCAGATGCGCAGCCTGGGG - Exonic
1077838328 11:5944995-5945017 GGACCCAGTTGAGCAAGGACTGG + Intergenic
1083139402 11:60709679-60709701 GGACTCAGTTGCGCAGACAGAGG - Intronic
1093015527 12:14150940-14150962 GGACCCAGTGTCACAGGCCCTGG + Intergenic
1099034816 12:77573084-77573106 GGACCCAGTAGCGATGGTGCTGG + Intergenic
1103722174 12:122980880-122980902 GGAGCCGGGTGCGCAGGCGTGGG + Exonic
1104987066 12:132603324-132603346 GGACCGCGTTGCGCGGGGGCTGG - Exonic
1109184384 13:59251844-59251866 GCACGCAGGTGAGCAGGCGCAGG + Intergenic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118574796 14:67231546-67231568 GGACCCAGTGGCTCAGGCTGAGG - Intergenic
1121048129 14:90802737-90802759 GGACGCTGCTGCGCAGGTGCAGG + Intronic
1121536618 14:94695435-94695457 GGACACAGTAGCGCAGCAGCGGG - Intergenic
1125201041 15:37100916-37100938 AGACCCAGTTAGGCAGGAGCCGG - Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1134490658 16:14693488-14693510 GCACACAGATGCGCAGGCACAGG - Intronic
1134496039 16:14732611-14732633 GCACACAGATGCGCAGGCACAGG - Intronic
1136154760 16:28375189-28375211 GCACACAGATGCGCAGGCACAGG + Intergenic
1136208332 16:28740069-28740091 GCACACAGATGCGCAGGCACAGG - Intergenic
1136264417 16:29106750-29106772 GCACACAGATGCGCAGGCACAGG - Intergenic
1137576767 16:49605098-49605120 GGACCCAGTGGCCCAGACCCAGG - Intronic
1140404012 16:74695652-74695674 GGACGCGGTGGCCCAGGCGCCGG + Exonic
1142206160 16:88784256-88784278 GGGCTCAGTTTCGCAGGGGCGGG - Intronic
1142299303 16:89247364-89247386 TGACCCAGCTGCGCATGAGCGGG + Intergenic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1147168193 17:38604464-38604486 GGAGCCAGGTGAGCAGGCGCGGG - Intronic
1148680528 17:49470970-49470992 GGACCCAGGAGGGCAGGCACTGG - Intronic
1148936486 17:51167269-51167291 GGACCCGAGTGGGCAGGCGCAGG - Intronic
1156400507 18:36735287-36735309 GTGCCCAGCTGCGCAGGTGCTGG + Intronic
1158393027 18:57058999-57059021 TGACCCAGGAGAGCAGGCGCTGG - Intergenic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1160451734 18:78971079-78971101 GGACCCAGGTTAGGAGGCGCCGG - Intergenic
1161063799 19:2227937-2227959 CGGCCCAGGTGCGCAGGCGGGGG - Intronic
1162573911 19:11487603-11487625 GCACCCACTTGCACAGGCACCGG + Exonic
1165065382 19:33225523-33225545 GGACCCAGGCGGGCGGGCGCCGG - Intronic
1166253317 19:41585907-41585929 GGCCCCAGCTGTGCAGGCTCAGG + Intronic
1166283571 19:41810389-41810411 GGTCCCAGCTGTGCAGGCTCTGG + Intronic
926195500 2:10761352-10761374 GGACCCCATTGCACAGGCACAGG - Intronic
928494040 2:31813520-31813542 GCACACAGGTGAGCAGGCGCAGG + Intergenic
929816559 2:45237519-45237541 GGACCCAGTGGCACAGCCACGGG + Intergenic
947229585 2:227871604-227871626 GGACGCGGGTGCGCATGCGCAGG - Exonic
947596956 2:231419016-231419038 GCACACAGTTGAGCAGGTGCAGG - Intergenic
947611914 2:231530095-231530117 GGAACCAGTTGGGAACGCGCAGG + Intronic
948468746 2:238164316-238164338 GGATGCAGATGAGCAGGCGCAGG - Exonic
1170824154 20:19778927-19778949 GGACCCAGATGCTCCGACGCTGG - Intergenic
1171444729 20:25195607-25195629 GGACCCAGTTGCGCAGGCGCGGG - Intergenic
1171444747 20:25195653-25195675 GCACCCAGCCGCGCATGCGCAGG - Intergenic
1179885184 21:44310849-44310871 GGACCCTGTTACCCAGGCCCTGG + Intronic
1183927763 22:41218113-41218135 GGACACAGTTGCGCTAGCCCAGG - Intronic
1184664198 22:45978756-45978778 GGACTCAGGCGCGCAGGGGCTGG + Intergenic
950920910 3:16693720-16693742 GGACCCTGTTGAGCAGGGTCAGG - Intergenic
954292604 3:49657716-49657738 GGAGCCAGATGGGCAGGCCCAGG + Exonic
955005529 3:54965291-54965313 GGACCCAGTTGTTCAGGCTGAGG - Intronic
955971940 3:64445227-64445249 GGCCACAGGTGCGCAGCCGCGGG + Intronic
957883622 3:86254642-86254664 GCACACAGATGGGCAGGCGCAGG + Intergenic
960705365 3:120475962-120475984 AGACCCAGCTGTGCAGGAGCAGG - Intergenic
961402189 3:126655158-126655180 GGACCCAATTTCGCATGCGCGGG - Intergenic
961439549 3:126944800-126944822 GGGCCCAGTGGCCCAGGCGTGGG + Intronic
962677929 3:137770148-137770170 GGAACCAGAAGCGCAGGAGCTGG + Intergenic
965693231 3:171380103-171380125 GGACCAGGTTGAGCAGGGGCTGG - Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
971279809 4:25233939-25233961 CGACCCTTCTGCGCAGGCGCGGG + Intronic
979530485 4:121764866-121764888 GCACCGAGCTGCGCGGGCGCTGG - Exonic
980989930 4:139730564-139730586 GGAGCCAGTCCCGCAGGCCCCGG - Exonic
1001408953 5:171496596-171496618 GGACCCAGCTCCACAGGCACCGG - Intergenic
1006502147 6:34465932-34465954 GCAACCAGTTTGGCAGGCGCCGG - Intergenic
1013964159 6:115935369-115935391 GGCCCCAGTGGCGTAGGCACCGG - Exonic
1014673706 6:124339044-124339066 GGACCCAGTGGCTCACGGGCTGG + Intronic
1016388748 6:143554045-143554067 GGATCCAGTGGCGGGGGCGCTGG + Intronic
1019703686 7:2487570-2487592 GGACCCAGATGCCCAGGCCTGGG + Intergenic
1019715973 7:2539548-2539570 TGACCCAGCTGAGCAGGCACTGG - Exonic
1019890279 7:3940950-3940972 GTACCCAGGTGCGCAGGTTCAGG - Intronic
1024255412 7:47537036-47537058 GAACCCGGTCGCGCCGGCGCCGG - Intronic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1035019059 7:155789491-155789513 GGACCCAGTCCTGCAGGCTCCGG - Intergenic
1038478498 8:27885553-27885575 GGACCCAGATGGGCAGGTGCTGG + Intronic
1040582077 8:48706305-48706327 AGACCCAGGTGGGCAGGCACAGG - Intergenic
1049017819 8:139933481-139933503 GGACCCATTTGGGCAGACACAGG + Exonic
1053299099 9:36936204-36936226 GGACCCAGTGGCCCAGGACCCGG + Intronic
1062009834 9:134261045-134261067 GGACCCAGATGGGGTGGCGCCGG - Intergenic