ID: 1171445089

View in Genome Browser
Species Human (GRCh38)
Location 20:25197018-25197040
Sequence TTTCTCTCCTTGGCAAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171445089_1171445091 -2 Left 1171445089 20:25197018-25197040 CCGGTTTTTGCCAAGGAGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 293
Right 1171445091 20:25197039-25197061 AAAACCTACTGAAACCCACCAGG 0: 1
1: 0
2: 1
3: 18
4: 155
1171445089_1171445094 9 Left 1171445089 20:25197018-25197040 CCGGTTTTTGCCAAGGAGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 293
Right 1171445094 20:25197050-25197072 AAACCCACCAGGAGGATGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 192
1171445089_1171445092 1 Left 1171445089 20:25197018-25197040 CCGGTTTTTGCCAAGGAGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 293
Right 1171445092 20:25197042-25197064 ACCTACTGAAACCCACCAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171445089 Original CRISPR TTTCTCTCCTTGGCAAAAAC CGG (reversed) Intronic
900940056 1:5792941-5792963 TTCCTCTCCTTGGCCAAGTCTGG + Intergenic
901756751 1:11446055-11446077 TTTCTGTCCCTGGCAACCACAGG + Intergenic
901977577 1:13007368-13007390 CTTCTCTCCTTATCAAAAAACGG + Intronic
902004508 1:13221567-13221589 CTTCTCTCCTTATCAAAAAACGG - Intergenic
904562534 1:31408408-31408430 CTTCTCTCCTTTGCAGTAACAGG + Intergenic
905871050 1:41404778-41404800 TTTCTTTCCTTGGCATAAATGGG + Intergenic
906285578 1:44585514-44585536 TTGCTGACCTTGGCAAAAGCAGG - Intronic
906840617 1:49134571-49134593 TTTCTCTTATTGCCAAAAACAGG - Intronic
906840669 1:49135093-49135115 TTTCTCTTATTGCCAAAAACAGG - Intronic
908517712 1:64910374-64910396 TTGCTCTCGTTGTCAAAAAAGGG + Intronic
908954752 1:69609675-69609697 GTTCTCACATTGGCTAAAACAGG - Intronic
910123018 1:83811117-83811139 TTTTTCTTCTTAGCAAAAGCAGG - Intergenic
910219522 1:84876372-84876394 TTCCTCTCATTGGCAGAAGCTGG - Intronic
910366305 1:86468929-86468951 TTTCTCTCTTTGGAAAATGCGGG - Exonic
910627526 1:89324227-89324249 TTTCTATCCTTGTCCTAAACAGG + Intergenic
911462054 1:98203597-98203619 CTTCTCCCCTTCGCAGAAACTGG + Intergenic
911997516 1:104786077-104786099 CATTTCTCATTGGCAAAAACGGG - Intergenic
912391012 1:109302889-109302911 TACGTCTCATTGGCAAAAACTGG - Intronic
912830256 1:112946429-112946451 TTTCTCTACTTCTCAAAAACTGG - Intronic
913995517 1:143649321-143649343 TTTCTTCCCTTGGCAAACAGTGG - Intergenic
917113466 1:171576931-171576953 TTTCTCTCTCCTGCAAAAACTGG - Intronic
917278182 1:173352960-173352982 TTTCTCTTATTGCCAAAAATGGG - Intergenic
918414705 1:184294619-184294641 TCTCTCTCCTTGTCAAAATCCGG - Intergenic
918694279 1:187524069-187524091 ATTCTCCCTTTGGCACAAACTGG + Intergenic
920676623 1:208042621-208042643 ATTCTATCCTTGGGAAAATCAGG - Intronic
921677632 1:217993951-217993973 TCTCTTTCCTGGGCACAAACAGG - Intergenic
922918248 1:229276605-229276627 TTTATCTTCTAGGCAAACACAGG - Intronic
923867810 1:237959224-237959246 CTTCTATACTTGGCAAAAAGAGG + Intergenic
924248956 1:242112090-242112112 TTACTCTCCTTCTCAATAACAGG + Intronic
1064893926 10:20212051-20212073 TTTCTCTCCTTGGTAATATGGGG - Intronic
1065112497 10:22453576-22453598 TTTCCCTCATTGGGAACAACTGG + Intronic
1065240928 10:23703306-23703328 TTTCTTTTCTTTGCAAGAACGGG + Intronic
1065248808 10:23788190-23788212 TTTCTTTCCTTTCCAGAAACAGG - Intronic
1065936189 10:30522579-30522601 TTTCTCTTATTACCAAAAACGGG + Intergenic
1067802849 10:49371108-49371130 TTTTTTTCCTTTGCAAAAAATGG - Intronic
1068491139 10:57725534-57725556 TTTGTGTCCATGGCAAAATCAGG + Intergenic
1068649374 10:59504348-59504370 CTTCTCTCTTTGGCCAGAACTGG - Intergenic
1070496232 10:77026187-77026209 TTTCTCTCCTTGGAACCAAAAGG + Intronic
1070987895 10:80703749-80703771 TTTCGCTCCTTGGAGAAACCAGG - Intergenic
1071184975 10:83032477-83032499 TTTCTCTCCTTGACTAACAGAGG + Intergenic
1071855426 10:89619670-89619692 TTACTCTCCATGGCAGCAACTGG - Intronic
1072267236 10:93742445-93742467 TTTCTGTCCTTAGGAAAAAGGGG - Intergenic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1073407519 10:103311005-103311027 TTTCTATCCTTTGTAAAGACGGG + Intronic
1074987095 10:118668383-118668405 GTTTTCTCCTTGGCAAGAAGAGG - Intergenic
1075566242 10:123506570-123506592 CTGCTCTACTTGGCAAAAGCTGG + Intergenic
1079523288 11:21354409-21354431 TTTCTCTCATTGGGTGAAACTGG + Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1081370283 11:42292044-42292066 TTTCTCTGCTTGCCAACAACAGG + Intergenic
1081481491 11:43493751-43493773 TTTCTCTCCTTGGCCCTCACAGG + Exonic
1084431689 11:69114802-69114824 TTTCTCTCCTAAGCAAAGCCTGG - Intergenic
1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG + Intronic
1086152628 11:83628880-83628902 TTTCTCTCCTTTTTAAAAAATGG - Intronic
1086534368 11:87826524-87826546 TAACTCTCCTTGGAAAAGACAGG + Intergenic
1087011761 11:93521122-93521144 TTTCTCTAACTGGCAAAACCAGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1088087865 11:106003145-106003167 TTTCTCTTATTGTCGAAAACAGG + Intronic
1088974220 11:114801010-114801032 TTTCTCTCATTTGCAAATAAAGG - Intergenic
1090345379 11:126064811-126064833 TTTCTCTGCTTTACAAAAAAAGG - Intergenic
1092180329 12:6442527-6442549 TTTCTTTCCTTTCCAGAAACAGG - Intergenic
1092812321 12:12283462-12283484 TTTATCTCCAAGGCAAAAATTGG - Intergenic
1093161344 12:15751014-15751036 TTTCTCTCCTTGTCACAATAAGG + Intronic
1093328269 12:17805850-17805872 TTTCTTCCATGGGCAAAAACTGG - Intergenic
1093707173 12:22287283-22287305 TTTCTCTCCTAGGAAACAAATGG - Exonic
1094228094 12:28069458-28069480 ATTCTCTTCTAGGCAAAAAATGG - Intergenic
1097172799 12:57127193-57127215 AGTCTGTCCTTGGCAGAAACAGG - Intronic
1098832515 12:75379374-75379396 TTTCTCTTCTTGACAATAAGAGG - Intronic
1102436350 12:112926973-112926995 TTTCTCTTATTACCAAAAACAGG - Intronic
1103284796 12:119791615-119791637 TTTCTCTCCATGGGGATAACTGG - Intronic
1105909276 13:24846351-24846373 TTTCTTTTATTGGCAAAAATTGG + Intronic
1106982716 13:35308038-35308060 TTTCTCTCCTTGGGAGATTCAGG + Intronic
1107908629 13:45084871-45084893 TTTCTCTGCTTGGCTAATTCAGG + Intergenic
1108853550 13:54765577-54765599 TTTCTCTGCTTGGCTAACACTGG + Intergenic
1109461295 13:62662134-62662156 TTTTTATTCTTGGCATAAACAGG + Intergenic
1111797632 13:92943669-92943691 TTTCTGTCGTTTGCAAAATCAGG - Intergenic
1112093526 13:96108081-96108103 TTTCTCTTATTGCCGAAAACGGG + Intronic
1113112641 13:106840631-106840653 TTTCTCTCCAAGGCACAAAAGGG + Intergenic
1113336739 13:109383764-109383786 TTTCTCACCTGGGCAGTAACAGG + Intergenic
1115310041 14:31969744-31969766 TTTTTTTCCTTGGCCAGAACTGG + Intergenic
1115525569 14:34277135-34277157 TATATCTCCTTGGCCAGAACTGG - Intronic
1116396647 14:44454974-44454996 TTTCTGTAGCTGGCAAAAACTGG + Intergenic
1117101369 14:52351785-52351807 TTATGCTCCTTGGCAAAGACTGG - Intergenic
1117583868 14:57180147-57180169 TTTCTCTTATTACCAAAAACGGG - Intergenic
1120295366 14:82633700-82633722 CTTCTCTTATTGCCAAAAACAGG + Intergenic
1120902717 14:89589849-89589871 TTCCTCTCCTAAGCAGAAACAGG - Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122363518 14:101181327-101181349 TTTTTCTCATTTGCAAAATCAGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123159514 14:106264403-106264425 TGTGTCTCTTTGTCAAAAACTGG - Intergenic
1124221116 15:27850624-27850646 TTTATCTCCTTGGCTGAAAAGGG - Intronic
1127629681 15:60815327-60815349 TGTCTCTCCCTGGCAAAACAAGG + Intronic
1128721199 15:69949823-69949845 TTTTTCTCCTTGTGAAAAATGGG - Intergenic
1129864229 15:78891175-78891197 AGTTTCTCCTTGGCAAAAAGAGG - Intronic
1130897420 15:88182169-88182191 TTTCTCTCTCTGGAAAGAACAGG - Intronic
1131551423 15:93360352-93360374 TTTCTCTACTGGAGAAAAACCGG - Intergenic
1131578955 15:93621483-93621505 TTTCTCTCATTTAAAAAAACTGG - Intergenic
1131710626 15:95051876-95051898 TTTTTCTCACAGGCAAAAACAGG - Intergenic
1132721419 16:1318130-1318152 TTTCACTCTTTGGCAAAGCCAGG - Intronic
1134307474 16:13046124-13046146 TGCCTCTCCTTGGGAAAAGCAGG + Intronic
1135598756 16:23763704-23763726 TTTGTCTCCTTGGCAAGGAGAGG - Intergenic
1136059092 16:27712436-27712458 TTTCTCTCATTGGTAAAATGAGG - Intronic
1137065571 16:35838560-35838582 TTTCTCCCCTTGCCGAAAAATGG - Intergenic
1137360905 16:47814212-47814234 TTTTTCTCCTTTGTAAAAAGTGG - Intergenic
1137535206 16:49316351-49316373 TTTTTCTCCTTGACATAAATAGG + Intergenic
1137623877 16:49895405-49895427 TTCCTCCCCTTGGCAAATTCAGG - Intergenic
1137626807 16:49914228-49914250 TATCTGTCCTTGGCAAGAAGAGG + Intergenic
1137724245 16:50646414-50646436 TTTATGTACATGGCAAAAACGGG + Intergenic
1137948154 16:52755787-52755809 TATTCCTCCATGGCAAAAACTGG + Intergenic
1140817685 16:78636053-78636075 TGTCTCTCCTAGGAAAACACAGG - Intronic
1142329697 16:89443671-89443693 TTTCTCTTGCTTGCAAAAACTGG - Intronic
1143281100 17:5754734-5754756 GTTCTTTATTTGGCAAAAACGGG + Intergenic
1143648679 17:8248984-8249006 CTTCTCTGCTTGGCAAGATCAGG - Intronic
1143936123 17:10485582-10485604 TTTCTCTTATTACCAAAAACGGG - Intergenic
1145299179 17:21618982-21619004 TTTCAATCCTAGGAAAAAACTGG + Intergenic
1145351100 17:22084300-22084322 TTTCAATCCTAGGAAAAAACTGG - Intergenic
1147384130 17:40071756-40071778 TTTCTGTCCGTGGCTAACACAGG + Intronic
1147841769 17:43376919-43376941 TTTCCCTTCTTGGCAAAGCCTGG - Intergenic
1148518331 17:48243497-48243519 TTTTTCCCCTTTGCAAAAACAGG - Intronic
1148543908 17:48502424-48502446 TTTCTCTCCTGGGGGAAAAGAGG - Intergenic
1148952101 17:51322274-51322296 TTTGTCTCCTCTGCAAAAAGTGG + Intergenic
1149625572 17:58078110-58078132 TTTCTCTTGATGGCAAAGACAGG + Intergenic
1150241577 17:63638249-63638271 TTACTCTCTTTGGCAAAATAAGG + Intronic
1150241756 17:63639695-63639717 TTACTCTCTTTGGCAAAATAAGG - Intronic
1154341965 18:13510954-13510976 TTTATCTGCTTGGAAAAAAATGG + Intronic
1155612090 18:27677202-27677224 TTTCCCTCATTGGCAAAATGGGG - Intergenic
1155744140 18:29330368-29330390 TTACTCTCCTTGGCCAATGCAGG + Intergenic
1156193285 18:34744684-34744706 TCTCTTTCCTTGGCAAAAGTGGG + Intronic
1156872486 18:41962611-41962633 TTTCGCTCTTTGGAAAATACGGG + Exonic
1159044848 18:63359842-63359864 TTTCTCTCCTTTGCAATAAACGG - Intronic
1160178693 18:76616291-76616313 TTTTTCTTTTTGGCAAAAATAGG + Intergenic
1164069761 19:21756610-21756632 TTTCTATCCATGGCATAAAATGG - Intronic
1164773610 19:30832666-30832688 TTTCTTTCTTTAGCAAAATCGGG + Intergenic
1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG + Intergenic
1167025037 19:46909717-46909739 TTTTTCCCCTTGGCAAATCCTGG + Intergenic
925519774 2:4730507-4730529 TTTCTCCTCTTGCCAGAAACAGG - Intergenic
927023728 2:19043980-19044002 TTTCTCCCCATGACAATAACAGG + Intergenic
927154398 2:20213271-20213293 TTTCCCCCCCTGGCAAAACCCGG + Intronic
927951616 2:27173821-27173843 TGACTCTCCTTGGCATAAATGGG - Intergenic
928897171 2:36279502-36279524 TTTCTCTTATTACCAAAAACGGG + Intergenic
929016736 2:37504932-37504954 TTTCTATCCTTTCAAAAAACAGG + Intergenic
930988244 2:57615782-57615804 TTTTTCTCCCTGACAAAAAATGG - Intergenic
931512727 2:63018563-63018585 CTTCTCTCCTTGGCACTCACTGG + Intronic
933188201 2:79302285-79302307 ATTCTCTCCTTGGCAATACTGGG + Intronic
933581428 2:84130979-84131001 TTTCCCTCTTGGGTAAAAACTGG - Intergenic
935966902 2:108487590-108487612 TTTTTCTCATTTTCAAAAACAGG + Intronic
936682254 2:114787291-114787313 TTTCTCTCCGTTTCTAAAACAGG - Intronic
937834670 2:126460149-126460171 TTTCTCTCCTTGGCATGAATTGG - Intergenic
938942228 2:136179387-136179409 TTTCTCTCCTGGGTCAGAACAGG - Intergenic
939141145 2:138356107-138356129 TCTCATTGCTTGGCAAAAACTGG - Intergenic
939348274 2:140997297-140997319 TATTTTTCTTTGGCAAAAACTGG + Intronic
939405414 2:141749426-141749448 TTTCTTTCCTGGGTGAAAACAGG - Intronic
942129109 2:172860477-172860499 TTTCTCTCCTGGATAAACACTGG - Intronic
942401621 2:175609303-175609325 TTTCTTTCCTTGGGAACAAACGG - Intergenic
943504458 2:188736176-188736198 TTTCTTCCATTGGCAAAAATAGG + Intronic
943893632 2:193323894-193323916 CTTCTCTGCTTGGCATGAACTGG - Intergenic
944151248 2:196561082-196561104 TTTCTCTTATTACCAAAAACGGG + Intronic
944403701 2:199358249-199358271 ATTCTCTCCTAGTCAATAACTGG + Intronic
945074063 2:206019836-206019858 TTTCTTTCCTTAGCATAAGCCGG - Exonic
945357183 2:208854737-208854759 TTTCTCTTATTGTCAAAAACGGG + Intergenic
946434223 2:219641314-219641336 TTCCTCTAGTTGACAAAAACAGG - Intronic
946568557 2:220995932-220995954 TTTTTCTCCTTTTCAAAAATTGG - Intergenic
1168763758 20:367804-367826 TTTCTCCCCTTTGCAGAAAAGGG + Intronic
1168930434 20:1619102-1619124 TCTCTCTCCTTGGCTTATACAGG - Intronic
1169543968 20:6631796-6631818 TTTCTTTCCTGAGCAAAAGCAGG - Intergenic
1170155360 20:13264255-13264277 TTTCTCTTTAAGGCAAAAACTGG - Intronic
1171222233 20:23409127-23409149 TTTCTCTCCAAGGCCAAGACAGG - Intronic
1171445089 20:25197018-25197040 TTTCTCTCCTTGGCAAAAACCGG - Intronic
1171561348 20:26129276-26129298 TTTCAATCCTAGGAAAAAACTGG - Intergenic
1172678698 20:36695417-36695439 TTTCTCTTATTGCCAAAAACAGG + Intronic
1173777811 20:45725607-45725629 TTTCTTTCCTTTGCTTAAACAGG + Exonic
1176649898 21:9536019-9536041 TTTCAATCCTAGGAAAAAACTGG + Intergenic
1176905957 21:14501903-14501925 TTTCTACCCTTGCCAATAACTGG - Intronic
1177361605 21:20079156-20079178 TATTTCTCATTGGCAAAAATGGG + Intergenic
1182106714 22:27694965-27694987 TGTCCCTCCTTGGCAGGAACTGG + Intergenic
1183018101 22:35006503-35006525 TTTCTCTTCTTGGCATAAGGGGG - Intergenic
1183826794 22:40394670-40394692 CTTCTAGCCATGGCAAAAACTGG - Intronic
949471870 3:4404964-4404986 TTTCTCAGTCTGGCAAAAACCGG - Intronic
950691129 3:14658859-14658881 TTTTTCTCCTAGGGAAAAATTGG + Exonic
951820716 3:26808048-26808070 ATTCTCTTCTTGATAAAAACAGG - Intergenic
951867710 3:27325936-27325958 TTTGTCCCCTTGGCAAAAAGGGG - Intronic
952194839 3:31064299-31064321 TTACTCTCCTTGGTATAAAGTGG - Intergenic
952761648 3:36920441-36920463 TTTATCTCCCTGACAGAAACTGG + Intronic
954506450 3:51080274-51080296 TTTCTCTACTGGAGAAAAACTGG + Intronic
955514881 3:59716564-59716586 TTTCTCTTATTGCCAAAAACGGG - Intergenic
957736330 3:84208475-84208497 TTTCTCTTCTTTGAAAATACAGG - Intergenic
958101010 3:89010596-89010618 TTTCACTCCTTCCCAAAAAATGG + Intergenic
959403991 3:105938334-105938356 TTTCTGGCCTTAGCAAAATCTGG + Intergenic
959936726 3:112037187-112037209 TTTCTCTTATTGCCAAAAATGGG + Intronic
959953547 3:112209954-112209976 TTTCTCTATTTTGCAGAAACAGG + Intronic
962665778 3:137652170-137652192 TCTCTCTCCTTGGCAATCAGTGG - Intergenic
962912141 3:139862819-139862841 TTTCTCTTATTGCCGAAAACGGG + Intergenic
962938032 3:140099629-140099651 TTCATCTCATTGGCAAGAACTGG + Intronic
963124951 3:141807413-141807435 TTTATCTCATTGGCCAAAACGGG + Intronic
963151100 3:142046230-142046252 GTTCTCCCCTAGTCAAAAACAGG + Intronic
965743840 3:171904509-171904531 TTTCTCTCTTTGGAATAAAGAGG + Intronic
966081707 3:176012466-176012488 TTTAACTCATTGGCAAAACCAGG + Intergenic
966817158 3:183898657-183898679 ATTCTGTCCTTGGCAGAAATTGG - Intergenic
967156935 3:186701794-186701816 TCTTCCTCCTTGGCAAACACAGG + Intergenic
967957069 3:194885543-194885565 TTTCTCCCATAGGCAGAAACAGG + Intergenic
967996623 3:195171687-195171709 TTTCTCTCCTCTTCCAAAACAGG + Intronic
970050942 4:11914492-11914514 TTTTTCTCCTTTACAAAAAAAGG + Intergenic
971815461 4:31481970-31481992 TATCTTTCTTTGGCAAAAAAAGG - Intergenic
974219086 4:58942506-58942528 TTTCTTTCTGTGGCAATAACTGG + Intergenic
974344479 4:60661651-60661673 TTTTTCTACATGGCAAAAAGGGG - Intergenic
974400339 4:61396073-61396095 TTTCCCTCCTTAGCTAAAACAGG - Intronic
975134245 4:70858723-70858745 TGTCTTTCCTTGGAAATAACTGG - Intergenic
975678274 4:76849847-76849869 TTTTTCTCCTGGGAAAAAAATGG - Intergenic
980577184 4:134698743-134698765 TTTCTCTCATTGCCGAAAATGGG + Intergenic
980994985 4:139771488-139771510 TTTCTCTCATTAGCAAATGCTGG + Intronic
982851440 4:160321182-160321204 TTTCTTTCCTTTGGAAATACTGG + Intergenic
984300799 4:177914906-177914928 TTTCTCTCCTTTTTAAAAATGGG + Intronic
986207344 5:5637488-5637510 TTTCTATCCATGGCAAAATATGG - Intergenic
986984615 5:13486115-13486137 TGTCTCACCTTGGCAATAACAGG + Intergenic
987219016 5:15770328-15770350 TTTATCTTCTTGGCAAGAACTGG - Intronic
987689724 5:21251484-21251506 TTTCTCTTATTACCAAAAACGGG + Intergenic
988504589 5:31810703-31810725 TTTCTGTACTTGGCAAACCCAGG - Intronic
988720227 5:33870035-33870057 TTTCTCTTATTGCCAAAAACTGG - Intronic
989372057 5:40721075-40721097 TTTCTTCCCTAGGCAAAATCTGG - Intronic
989513940 5:42319928-42319950 TTTCTCTTATTGCCAAAAACAGG - Intergenic
989549605 5:42718844-42718866 TTTCTCTGCTTGGATAACACTGG - Exonic
989828689 5:45889790-45889812 TTTCTCTCATTACCGAAAACGGG - Intergenic
989830810 5:45915889-45915911 TTTCTCTTATTGCCAAAAACTGG - Intergenic
990942641 5:61218737-61218759 CTTCTCTCCTTTTCTAAAACAGG + Intergenic
991060117 5:62365779-62365801 TATCTCCCCTGGGCAACAACTGG + Intronic
991695764 5:69269607-69269629 TTTGACTCCTTGACAAAAATGGG + Intronic
992494150 5:77275364-77275386 TTTCTTTCCTTCCCAAAAAGAGG + Intronic
993716683 5:91281731-91281753 TTTCTCTCCTTTACAAAATTGGG - Intergenic
994940827 5:106321755-106321777 TTACTTTCCAGGGCAAAAACTGG + Intergenic
995332718 5:110963412-110963434 TTTTTCTCTTTGGCTAAAACTGG + Intergenic
996623529 5:125540548-125540570 TTTCTTTTCTTGTCAAAAACTGG + Intergenic
996676732 5:126183984-126184006 TTTCTCTCTTTTACAAAAACAGG + Intergenic
998820345 5:146052325-146052347 TTTCTCTCCTTGGCCAAGGTCGG + Intronic
1000122744 5:158212798-158212820 ATTCTCTCCTTGGCAATGAAGGG + Intergenic
1000197105 5:158970359-158970381 TTTGTCTCCTTGGCAATTTCCGG - Intronic
1000574594 5:162961816-162961838 TTTCTCTAGATGGCAAAAGCAGG - Intergenic
1000764366 5:165267490-165267512 TTTGTCTCCTTCACAAGAACAGG + Intergenic
1001853862 5:174993874-174993896 TTTTTTTCTTTGGCAAAAATAGG - Intergenic
1003394033 6:5737672-5737694 TTATTCTCATTGGCCAAAACTGG - Intronic
1003806766 6:9734340-9734362 TTTATCTACTTTTCAAAAACAGG + Intronic
1004137804 6:12984988-12985010 CTTCTATACTTGGCAAAAGCCGG + Intronic
1004720300 6:18263316-18263338 TTTCCCTCCCTGGCAAACAGCGG - Intronic
1006746031 6:36342667-36342689 TGTGTCTCATTGGCTAAAACTGG + Intergenic
1009039055 6:58155821-58155843 TTTCTCTTCTTACCAAAAACGGG + Intergenic
1009758807 6:67977390-67977412 TGTCTATCCTTAGGAAAAACTGG + Intergenic
1010455688 6:76051818-76051840 TTTCTCTTCTTGCAAAAATCAGG + Intronic
1010472610 6:76247179-76247201 AATCTCTCCTTAGCAAAACCAGG - Intergenic
1010506790 6:76670570-76670592 TATGTCTCATTGGCTAAAACTGG + Intergenic
1011079355 6:83472497-83472519 TTTGTTTCCTTGGCTGAAACAGG + Intergenic
1011208979 6:84934005-84934027 CTTATTTCCTTGGCTAAAACTGG - Intergenic
1011251464 6:85376499-85376521 TATTTCTGCATGGCAAAAACTGG + Intergenic
1011586495 6:88932045-88932067 TTTCCCTTATTGCCAAAAACAGG + Intronic
1011728633 6:90236644-90236666 TTTCTCTTCTGGACAAACACAGG - Intronic
1013641257 6:112084474-112084496 TTTATCTCATTGGCTAGAACTGG - Intronic
1013668091 6:112367977-112367999 CTTCTCTCTTTGGCCAGAACTGG + Intergenic
1015006130 6:128284022-128284044 TCTCTCTCTTTTTCAAAAACTGG + Intronic
1015259205 6:131215429-131215451 TTTCCCTCCCTGTCAAGAACAGG + Intronic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016357984 6:143238473-143238495 TTTATCTCATTGGCTACAACTGG + Intronic
1016453050 6:144203288-144203310 TATCTCTCATTGGCCAGAACTGG + Intergenic
1017898794 6:158703320-158703342 TTCCTGTCCCTGGCAAAGACGGG + Intronic
1018044412 6:159953121-159953143 TTTCTCTCCTAGCCTAAAGCTGG + Intergenic
1018588704 6:165391923-165391945 TTTCTCTCCTCTGTAAAAACTGG - Intronic
1018598901 6:165517416-165517438 TTTCTCTTCATGGGAAATACTGG - Intronic
1018764088 6:166916766-166916788 TGTGTCTCCATGGCAAAATCTGG + Intronic
1019002868 6:168770155-168770177 TTTCTCTTATTGCCGAAAACAGG - Intergenic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1020119388 7:5494705-5494727 TTTCTCTCCAAAGCAAAAGCAGG + Intronic
1022929063 7:35091601-35091623 TTTGTCACTTTGGAAAAAACTGG + Intergenic
1023093769 7:36640157-36640179 TCCCCCTCCTTGGCAAAAGCTGG - Intronic
1023668829 7:42554979-42555001 TTTCTCTTATTGCCGAAAACAGG + Intergenic
1024585503 7:50838483-50838505 TTTCTCTCACTGACAAAAGCTGG - Intergenic
1024756706 7:52541708-52541730 TTTCTCTTATTACCAAAAACGGG - Intergenic
1024812821 7:53234072-53234094 TGTCACTCCTTGGTCAAAACTGG - Intergenic
1024946102 7:54808937-54808959 TTTCTCTTATTACCAAAAACGGG + Intergenic
1026188307 7:68101490-68101512 TATCTGTCCTTGGCATAAAATGG + Intergenic
1027201361 7:76065775-76065797 TGTCTGACATTGGCAAAAACAGG - Intronic
1028403938 7:90456161-90456183 TTTCTCTCCTTGGCTCACAGAGG - Intronic
1028515960 7:91678561-91678583 TTTCTATCCATGGCAAAATTAGG - Intergenic
1030025202 7:105316869-105316891 TTTATCTCATTTGCAAAAAGGGG + Intronic
1030574964 7:111274103-111274125 TTTTTCCCCCTGGGAAAAACAGG - Intronic
1031322071 7:120343231-120343253 TTCTTCTCCTTGGCACACACTGG - Intronic
1031538977 7:122970162-122970184 CTCCTCTCCTTTGCAAAAACAGG - Intergenic
1032655649 7:133926506-133926528 GTTCTCTCCTTTCCAATAACAGG + Intronic
1033677111 7:143553540-143553562 TTTCTCTCCTTACCAAAAACGGG - Intergenic
1033694724 7:143775897-143775919 TTTCTCTCCTTACCAAAAACGGG + Intergenic
1034080301 7:148270878-148270900 GTTCTCTCCTTTGCAAAATGGGG + Intronic
1034142009 7:148828944-148828966 TTTTTCTACTTGGACAAAACAGG + Intronic
1035068944 7:156127006-156127028 TTTGTCTCTTTAGTAAAAACGGG + Intergenic
1035572877 8:685250-685272 TTTCTCTTATTGCCGAAAACGGG - Intronic
1037265667 8:17056847-17056869 TTCATCTCCTTGGCAATAGCTGG + Intronic
1037311999 8:17565866-17565888 TTTGTCTCCTTTGCAAACAGTGG + Exonic
1037665406 8:20964770-20964792 TGTCTCTCATTTGCAAAAATAGG + Intergenic
1039111413 8:34044170-34044192 TTTCTCTTATTACCAAAAACAGG - Intergenic
1041966675 8:63686372-63686394 ATTCTCTCCTTAGTCAAAACAGG + Intergenic
1042370878 8:67989096-67989118 TTTCTCTCCTTCTCCTAAACTGG - Intronic
1044170324 8:89043431-89043453 TTTCTCTTGTTACCAAAAACGGG + Intergenic
1045279727 8:100739582-100739604 TTTTTCTTTTTGGCAGAAACAGG - Intergenic
1046187829 8:110746366-110746388 TTTCTCTTATTACCAAAAACGGG + Intergenic
1050085765 9:1964206-1964228 TTTCTTTGCTTGAGAAAAACAGG - Intergenic
1051209555 9:14727287-14727309 GTTCTCTCCATGGCAAGGACAGG - Intergenic
1052161831 9:25271998-25272020 TTTCTCACCATGTCAAAAGCTGG + Intergenic
1052607430 9:30723042-30723064 TTTATCTCCTTGAGAAAAGCAGG + Intergenic
1056950296 9:91036155-91036177 TTTCTGTCCTGAGCAAAGACAGG + Intergenic
1058253288 9:102729297-102729319 TTTCTCTTGTTGCCGAAAACAGG - Intergenic
1058424461 9:104864381-104864403 TTTCTGTTCTTGGGAGAAACAGG + Intronic
1058549031 9:106093557-106093579 TTTCTCTTATTACCAAAAACGGG + Intergenic
1060059188 9:120444003-120444025 TCTCTCTTCTTGGGAAAAATGGG - Intronic
1060290867 9:122301275-122301297 TTGCTCTCCCTGGAAAAACCTGG - Intronic
1061697968 9:132392146-132392168 ATTCTCTCCTTGGGAATGACTGG - Exonic
1203627640 Un_KI270750v1:39567-39589 TTTCAATCCTAGGAAAAAACTGG + Intergenic
1187260094 X:17677565-17677587 TTGCTCTCCTTAGCATGAACTGG - Intronic
1187449410 X:19383261-19383283 ATTCTCTCCATGGAAATAACTGG + Intronic
1187638310 X:21258649-21258671 TTTTTCTTTTTGGCAGAAACTGG - Intergenic
1188107823 X:26164564-26164586 TGTCTCTCCCTGGCAAACCCAGG + Intergenic
1188111211 X:26197786-26197808 TGTCTCTCCCTGGCAAACCCGGG + Intergenic
1188813198 X:34678782-34678804 TTTGTGGCCTTGCCAAAAACTGG - Intergenic
1189075327 X:37908386-37908408 TTTATCTCATTGGCAATATCTGG + Intronic
1189214652 X:39312483-39312505 GTTCTCTCCTTGGCCGCAACAGG - Intergenic
1189755163 X:44263911-44263933 TTTTTCTAGGTGGCAAAAACTGG + Intronic
1190152824 X:47962364-47962386 TTTCTCTTATTGCCAAAAACGGG - Intronic
1193549584 X:82874077-82874099 TTTCTCTCTTTTGCAAAATTGGG - Intergenic
1194909599 X:99624710-99624732 TTTCTTTCCTTAGATAAAACAGG - Intergenic
1195838294 X:109144100-109144122 TTTCTCTTATTTCCAAAAACGGG + Intergenic
1196052523 X:111320681-111320703 TTTTTCCCCTTGGCAACAAGGGG + Intronic
1196713477 X:118787750-118787772 TTTCTCTTATTGCCAAAAACAGG - Intronic
1197164157 X:123358018-123358040 TTTATCTGCTTTGAAAAAACTGG - Intronic
1200942262 Y:8797118-8797140 TGTCTATTCATGGCAAAAACAGG + Intergenic
1201792602 Y:17858801-17858823 TTTGTCTTATTGCCAAAAACAGG + Intergenic
1201808952 Y:18047185-18047207 TTTGTCTTATTGCCAAAAACAGG - Intergenic