ID: 1171445950

View in Genome Browser
Species Human (GRCh38)
Location 20:25205166-25205188
Sequence CCACTAGGCCATGAGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171445950_1171445956 3 Left 1171445950 20:25205166-25205188 CCTGGGGGCTCATGGCCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1171445956 20:25205192-25205214 GACACAGACCTACAGGAATCAGG 0: 1
1: 0
2: 1
3: 15
4: 162
1171445950_1171445958 17 Left 1171445950 20:25205166-25205188 CCTGGGGGCTCATGGCCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1171445958 20:25205206-25205228 GGAATCAGGTCTATGAATACTGG 0: 1
1: 0
2: 0
3: 9
4: 94
1171445950_1171445955 -4 Left 1171445950 20:25205166-25205188 CCTGGGGGCTCATGGCCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1171445955 20:25205185-25205207 GTGGGGAGACACAGACCTACAGG 0: 1
1: 0
2: 3
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171445950 Original CRISPR CCACTAGGCCATGAGCCCCC AGG (reversed) Intronic
901189876 1:7403379-7403401 TCACTAGGCCATGAGCTGCTTGG - Intronic
901634853 1:10665729-10665751 CCACTAGTCTATGAGCTCCGTGG + Intronic
901799051 1:11696776-11696798 CCAGGAGGCAATGAGCCTCCTGG + Intronic
901810720 1:11765664-11765686 CCCCTACTCCAAGAGCCCCCGGG + Intronic
903472309 1:23595692-23595714 CCTCCAGGCCATCATCCCCCTGG + Intronic
903926127 1:26831953-26831975 CCACTAGACCATAAGCCACAAGG + Intronic
904254094 1:29243688-29243710 CCACTAGGCTGGGAGCCCCCAGG + Intronic
904254204 1:29244190-29244212 CCACTAGTCTGGGAGCCCCCGGG - Intronic
904675777 1:32198552-32198574 TCACTAGCCTGTGAGCCCCCAGG - Intergenic
909878974 1:80848519-80848541 GCCCCAGGCAATGAGCCCCCAGG + Intergenic
912411767 1:109484763-109484785 CCACGAGGCCAGGTGCTCCCTGG - Intronic
915366073 1:155316983-155317005 CCACTAGACCATGATCTCCTTGG - Intronic
915740597 1:158115825-158115847 CCACTAGACCAGGAGCCTCCGGG + Intergenic
916068786 1:161157945-161157967 CCACTAGGCCAGCAGACCCTGGG - Intronic
916854862 1:168738805-168738827 CCACTAGGCCATGTTGTCCCTGG + Intergenic
917431543 1:174974704-174974726 CCACTGGGCTATGAGCCATCAGG + Intronic
919692190 1:200537842-200537864 CCACCAGGCCATGTTCCCACTGG + Intergenic
919881354 1:201903283-201903305 TCACTAGGCCCTGTGCCCCTTGG - Intronic
919973623 1:202596811-202596833 CCACTGGGCGATGGGCCTCCGGG + Exonic
920089438 1:203441777-203441799 CTTCTAGGGCATGAGCCTCCTGG + Intergenic
922902596 1:229148280-229148302 CCACAGGGCCATGACCACCCTGG + Intergenic
923520574 1:234732264-234732286 CCACTAGACTGTGAGCTCCCTGG - Intergenic
924362599 1:243256271-243256293 CCACTAGGCCCTGGGCACCTCGG - Intronic
1063029150 10:2214510-2214532 CCACTAGGACAGGAGCCTCAGGG - Intergenic
1067142680 10:43669786-43669808 CCATGAGTCCTTGAGCCCCCTGG + Intergenic
1069807013 10:71132468-71132490 CCCCCAGGCCACAAGCCCCCAGG + Intergenic
1070130708 10:73653564-73653586 CCACTAAGTCCTGAGCCCCCTGG - Exonic
1071507261 10:86240329-86240351 TCACTAGGACATGAGCTTCCTGG + Intronic
1071517792 10:86310494-86310516 CCAATATGCCTTGAGCCCTCAGG + Intronic
1072446556 10:95503834-95503856 CCATTTGGCCATGACCCCCATGG - Intronic
1077610893 11:3642511-3642533 CCACCAGGCCAGGGGCCCCGCGG + Intergenic
1078094363 11:8287586-8287608 CCTCCAGGCCAGGAGCCTCCTGG - Intergenic
1079140018 11:17802390-17802412 CCACTAGGGGCTGAGCCCACAGG - Intronic
1080394649 11:31878773-31878795 CCACTAGCCAATGAGCTCCTGGG - Intronic
1081570691 11:44289024-44289046 CCACTAGGCCATGATTCCTAAGG - Intronic
1082184735 11:49165273-49165295 CCACTAGACGATAAGTCCCCTGG + Intronic
1083994267 11:66264490-66264512 CCACTCTGCCATCAGCACCCAGG + Intronic
1083995949 11:66272415-66272437 CGATGATGCCATGAGCCCCCCGG - Exonic
1086776525 11:90842045-90842067 TCACTAGGCTGTGAGACCCCAGG + Intergenic
1089651262 11:119914935-119914957 CCACTAGGCCATAATCCACTAGG - Intergenic
1090478630 11:127047920-127047942 CCATTGGGCCATGAGGCCCCAGG - Intergenic
1091368123 11:135038653-135038675 CAACCAGGCCAGGAGGCCCCAGG + Intergenic
1091994408 12:4981976-4981998 CCAGTAGACGATGAGCTCCCTGG - Intergenic
1092024757 12:5231362-5231384 CCATTAGGCTATGTGCCCCATGG - Intergenic
1101702157 12:107184198-107184220 CCACTAGACCCTGAACCCCCAGG + Intergenic
1102199882 12:111049876-111049898 CCACTAGGACAGGGGCTCCCTGG + Intronic
1104042582 12:125140073-125140095 CCACTTGGCCATGACCCTCGCGG - Intronic
1118327859 14:64793550-64793572 CAACCATGCCATGAGCCTCCTGG + Exonic
1119853127 14:77880237-77880259 GCACAAGGCCATCACCCCCCTGG - Intronic
1120948770 14:90022085-90022107 CAACTAGCCTATGAGCTCCCTGG - Intronic
1121580437 14:95025899-95025921 GCAGAAGGCCATGAGCCTCCAGG - Intergenic
1121826977 14:97018364-97018386 TCACTAGAACATGAGCCCACGGG - Intergenic
1122070726 14:99203959-99203981 CCAGGATGCCATCAGCCCCCAGG + Intronic
1123020551 14:105395928-105395950 AAACCAGGCCAAGAGCCCCCAGG - Exonic
1125598731 15:40903899-40903921 CCACAAGGCCCTCAGCCCCAGGG - Exonic
1129680053 15:77653662-77653684 CCACCATGCCATGTGCCCCTCGG + Intronic
1130418373 15:83715551-83715573 CCACCAGGCTTTGAGCCCCTAGG + Intronic
1130563352 15:84975907-84975929 CCTCCAGGCCAGGAGGCCCCAGG + Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1132221894 15:100111233-100111255 ACACTTGTCCATGAGCCCACTGG - Intronic
1132967991 16:2670165-2670187 CCACTGGGCCACGATCCGCCGGG + Intergenic
1137576990 16:49606561-49606583 CCTCTGGGACCTGAGCCCCCTGG - Intronic
1139600728 16:67985096-67985118 ACACTTGGCCATTAACCCCCAGG - Intergenic
1141139401 16:81487358-81487380 CCACTCGGCCCTGACCACCCAGG - Intronic
1149676027 17:58462637-58462659 CCACTGGGACATGATCCTCCTGG + Intronic
1151399144 17:73844113-73844135 CCAACAGGACAAGAGCCCCCTGG - Intergenic
1151477421 17:74352058-74352080 CCACGAGGCCGTGCGCCGCCTGG + Exonic
1152226168 17:79093917-79093939 CCAGGACGCCAGGAGCCCCCAGG + Intronic
1153822067 18:8840544-8840566 CAACTAGGTCAGGAGCCCCTGGG - Intergenic
1157402304 18:47398738-47398760 CTGCTAGACCATGAGCTCCCAGG + Intergenic
1158588766 18:58762602-58762624 CCACTAACCCATGGGCCACCTGG - Intergenic
1161283219 19:3456691-3456713 CCTCTTCGCCCTGAGCCCCCCGG - Intronic
1162910001 19:13843305-13843327 CCAGGAGGCCGTGAGCCCCTGGG + Intergenic
1163939198 19:20477209-20477231 CCACCAGGCCATGCCCCCTCAGG - Intergenic
1165061380 19:33206841-33206863 CCACCTGGCCATGGGCCCTCAGG - Intronic
1165235879 19:34421164-34421186 CCCCCAGGCCATGGACCCCCAGG - Intronic
1165721202 19:38081330-38081352 CCACTCGGTCTGGAGCCCCCAGG + Exonic
1166368740 19:42290293-42290315 CCACTGGACCCTGAGCCCCCAGG + Exonic
1166670409 19:44706522-44706544 CCAAGTGGCCATCAGCCCCCGGG + Intronic
1167605838 19:50480929-50480951 CCAGAAGGCCAAGAACCCCCAGG + Exonic
925320381 2:2961830-2961852 CCACTAGACTTTGAGCTCCCAGG - Intergenic
925619892 2:5781917-5781939 CCACTAGGGCGTGAGCCCGCAGG + Intergenic
927877724 2:26670093-26670115 CCACTAGAATATGAGCCCCATGG - Intergenic
928102914 2:28449801-28449823 CCTCTGGACCATGAGCTCCCGGG + Intergenic
928401896 2:30985027-30985049 CCACTAGGCCATGAGCTCCTAGG + Intronic
930882954 2:56292685-56292707 ACACTGGGACATGAGACCCCTGG + Intronic
931176441 2:59859514-59859536 CCACTAGGACAAGATCCCTCTGG + Intergenic
934961981 2:98683841-98683863 CCAATAGTCCATGGGCCCCCAGG - Intronic
936117237 2:109711936-109711958 CCACTAGGCCATGTTCCTCAGGG + Intergenic
948885267 2:240879062-240879084 TCCCCAGGCCATGAGCCTCCCGG + Exonic
1169675101 20:8144277-8144299 CCACTAAGCCAGGAGCACCTCGG + Intronic
1171369082 20:24649017-24649039 CCACTAGACCATAATCCCCAAGG - Intronic
1171445950 20:25205166-25205188 CCACTAGGCCATGAGCCCCCAGG - Intronic
1172777870 20:37417726-37417748 CCACTCGGCTCTGAGTCCCCTGG + Intergenic
1172782975 20:37448032-37448054 CCAATAGGTCAGGGGCCCCCAGG - Intergenic
1173191111 20:40876199-40876221 CCACTGGACCATAAGCCCCAGGG - Intergenic
1174109859 20:48191461-48191483 CCACTAGGCCATTGGCTTCCAGG + Intergenic
1175726187 20:61320364-61320386 CCACCAGGCTGTGAGCCCCCAGG - Intronic
1177497088 21:21903523-21903545 CAACGAGACCATGAGCCCACCGG + Intergenic
1177991133 21:28037576-28037598 CCACTAGACCACTAGACCCCTGG + Intergenic
1180089387 21:45526038-45526060 CCACCAGCCCATGACCCGCCCGG + Intronic
1181616957 22:24061446-24061468 CCACCAGGCCATGCTCCCCTGGG + Intronic
1181819246 22:25462736-25462758 CCACCCGGCCATGAGCCCCAAGG - Intergenic
1182288768 22:29263643-29263665 CCACCAGGCCATAAGACCCCAGG + Intronic
1182578619 22:31290799-31290821 CCAATAGGCTTTGAGCCCCGCGG + Intronic
1183315477 22:37134799-37134821 CCACTGGGCCGTGAGCTGCCTGG + Intronic
1184098902 22:42331244-42331266 CCGCTAAGCCACGAGCCACCGGG + Intronic
1184406865 22:44305373-44305395 CTACTAGGCCATGAGGGTCCTGG + Intronic
1184928767 22:47664011-47664033 CCACTAGGCGGTGAGTTCCCAGG + Intergenic
1185421927 22:50739559-50739581 CCACTTGGCCCAGAGCCCCAGGG - Intronic
950200332 3:11037767-11037789 CCAGTAGGACCTGAGGCCCCTGG - Exonic
952846200 3:37689924-37689946 CCAATAGGCCATGAGCTCCCTGG - Intronic
952960099 3:38583591-38583613 CCACCAGCCCATGAGCCCAGAGG - Intronic
954456598 3:50603040-50603062 CCTCTAGGCCTTTAGGCCCCCGG + Intergenic
961360483 3:126364301-126364323 CCCCTAGACCATGAGCACCATGG + Intergenic
965132366 3:164717506-164717528 CTAGTAGGACATGAGCCCACAGG + Intergenic
965406747 3:168278455-168278477 CCACTAGGCCATGTTCCTTCCGG + Intergenic
967217420 3:187222288-187222310 CCACTTGACCATGAGCCCAAGGG + Intronic
968760076 4:2438184-2438206 CCACCAGGCCACGAGGCCCACGG + Intronic
968965441 4:3766935-3766957 CCAGTAGGCCATGAGCTCGTTGG - Exonic
969286623 4:6206442-6206464 CCACTGGCCCATGAGCCCTTGGG - Intergenic
969699748 4:8761624-8761646 CCACCAGGCTGTGAGCCTCCGGG - Intergenic
969760132 4:9175522-9175544 GCTCCAGGCCATCAGCCCCCAGG + Exonic
971362100 4:25947554-25947576 CCTCAAGGCCAGGAGCCACCAGG + Intergenic
971663546 4:29452319-29452341 CCCCTAGCCCATGAGCCCTTAGG - Intergenic
975516229 4:75251379-75251401 ACACTAGGGCTGGAGCCCCCAGG - Intergenic
978457146 4:108906747-108906769 CCACTAGTCTATGAGCTCCTTGG + Intronic
987187588 5:15440966-15440988 CCAGAAGAACATGAGCCCCCCGG - Intergenic
989699480 5:44244755-44244777 ACATTAGACCATGAGCCCCAAGG + Intergenic
994935417 5:106247124-106247146 CCGCGAGACCATGAGCCCACTGG + Intergenic
1002163003 5:177327877-177327899 CCACTAGACTATGAGCTCCATGG + Intergenic
1002372888 5:178768937-178768959 CCACTTGGCCATGACCCGCCCGG + Intergenic
1002582333 5:180216289-180216311 CCACAAGGACATGGGCACCCTGG - Intergenic
1002940894 6:1714857-1714879 CCACTAGGGCATGATGCCTCCGG - Intronic
1003778761 6:9398964-9398986 CTACAAGGCCTTGAGCACCCGGG + Intergenic
1004318312 6:14611522-14611544 CCAGTATGCCAAAAGCCCCCGGG - Intergenic
1006077804 6:31545566-31545588 CCCCCAGGCCATGGGCTCCCAGG - Exonic
1006255226 6:32827422-32827444 CCACTAGACCATGAGCACCTGGG - Intronic
1008710918 6:54226236-54226258 CCACTATGCCAGGAGGCCCCAGG - Intronic
1019191114 6:170251537-170251559 CCACTGGGCCTGGAGCCCCGTGG - Intergenic
1022657255 7:32330892-32330914 CCACAAGGCCATCGGTCCCCTGG + Intergenic
1023191123 7:37584221-37584243 CCAGAAGGCGATGACCCCCCTGG - Intergenic
1023791607 7:43758027-43758049 CCACTAGGCTAGAAGCTCCCTGG + Intergenic
1025981467 7:66410787-66410809 GCAGTAGACTATGAGCCCCCAGG + Intronic
1027333232 7:77121846-77121868 CCACCTGGCCGTGAGGCCCCTGG - Intergenic
1029782560 7:102749456-102749478 CCACCTGGCCGTGAGGCCCCTGG + Exonic
1030099621 7:105933946-105933968 CAACTGGTCTATGAGCCCCCTGG - Intronic
1035950127 8:4010743-4010765 GCATTAGGCCATGAGCCCTAAGG - Intronic
1036522680 8:9506707-9506729 CCACTAGGCTGTGAGCTCCCTGG - Intergenic
1044088365 8:87970432-87970454 CCACTAGGCCATGAGTTCAGAGG - Intergenic
1046257645 8:111722015-111722037 CCACTAGGCCATGCCCCAGCAGG + Intergenic
1048838633 8:138545546-138545568 CAATTAGGTCATGAGCACCCAGG + Intergenic
1049122337 8:140750394-140750416 CCTCTAGGCCTTAAGCTCCCTGG - Intronic
1049376867 8:142293532-142293554 CCACTGGGCCATGTGACCCTGGG - Intronic
1049600249 8:143504231-143504253 TCTCCTGGCCATGAGCCCCCAGG - Intronic
1049665171 8:143839735-143839757 CCACAAGGCCATGAACGCCCGGG - Exonic
1053379544 9:37637038-37637060 CGAGGAAGCCATGAGCCCCCCGG + Intronic
1054929018 9:70617326-70617348 ACTCTAGGCCAAGAGCCCACAGG + Intronic
1057395550 9:94676657-94676679 CAGCTAGGCCAAGAGCCCACTGG - Intergenic
1057697950 9:97340724-97340746 CCACTAGACCATGGTCCGCCTGG - Intronic
1059420401 9:114186964-114186986 GCACTGGGCCATGAGGCTCCTGG + Intronic
1061997264 9:134192840-134192862 CCCCCAGGACTTGAGCCCCCTGG + Intergenic
1062253368 9:135609174-135609196 CCCCCAAGCCCTGAGCCCCCAGG + Intergenic
1062552838 9:137097965-137097987 CCACCAGCCCCTGAGCGCCCGGG - Intronic
1191675079 X:63785017-63785039 CCACAAGGCAGTGAGCACCCTGG - Intronic
1191818522 X:65275279-65275301 CCACTGGCCTATAAGCCCCCAGG + Intergenic
1199042905 X:143135498-143135520 CCCCTAAGACAGGAGCCCCCTGG - Intergenic
1199972904 X:152873686-152873708 CCACTAGCTCCTGATCCCCCAGG + Intergenic