ID: 1171448362

View in Genome Browser
Species Human (GRCh38)
Location 20:25220205-25220227
Sequence CAGCAAACAGCAGTCGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171448358_1171448362 -3 Left 1171448358 20:25220185-25220207 CCCCAAGTAGAGTGAAAGAACAG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG 0: 1
1: 0
2: 2
3: 45
4: 216
1171448355_1171448362 18 Left 1171448355 20:25220164-25220186 CCGGTTATTGCGTAACAGACCCC 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG 0: 1
1: 0
2: 2
3: 45
4: 216
1171448359_1171448362 -4 Left 1171448359 20:25220186-25220208 CCCAAGTAGAGTGAAAGAACAGC 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG 0: 1
1: 0
2: 2
3: 45
4: 216
1171448357_1171448362 -2 Left 1171448357 20:25220184-25220206 CCCCCAAGTAGAGTGAAAGAACA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG 0: 1
1: 0
2: 2
3: 45
4: 216
1171448356_1171448362 -1 Left 1171448356 20:25220183-25220205 CCCCCCAAGTAGAGTGAAAGAAC 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG 0: 1
1: 0
2: 2
3: 45
4: 216
1171448360_1171448362 -5 Left 1171448360 20:25220187-25220209 CCAAGTAGAGTGAAAGAACAGCA 0: 1
1: 0
2: 0
3: 20
4: 206
Right 1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG 0: 1
1: 0
2: 2
3: 45
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171448362 Original CRISPR CAGCAAACAGCAGTCGCGGC TGG Intronic
900589704 1:3454255-3454277 CAGCAAACATCGGTCCCCGCAGG + Intergenic
901836174 1:11925674-11925696 CAGCAGCACGCAGTCGCGGCCGG + Exonic
902520484 1:17012934-17012956 CAGTAGACAGCAGTCTCCGCAGG - Intergenic
904656470 1:32051929-32051951 CAGCAAACAGCAGCCTCTGTAGG - Intronic
905181468 1:36169740-36169762 CAGCAAACAGCACTCCCTGTTGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
910354219 1:86336826-86336848 CAGAAAACAGAAGTGGAGGCAGG + Intergenic
913703513 1:121396767-121396789 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
913703523 1:121396811-121396833 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
914133941 1:144883212-144883234 CCGCAAAAAGCAGCGGCGGCGGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922819651 1:228475394-228475416 GAGCAAACAGCATTCCTGGCAGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1066950448 10:42111836-42111858 CCGCAAAAAGCAGCAGCGGCAGG + Intergenic
1066950539 10:42112264-42112286 CTGCAAAAAGCAGCAGCGGCAGG + Intergenic
1066950638 10:42112695-42112717 CTGCAAAAAGCAGCGGCGGCGGG + Intergenic
1066954502 10:42150944-42150966 GAGCAAAAAGCCGTGGCGGCGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070757658 10:79003475-79003497 CAGCAGACAGCGGGGGCGGCTGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073061333 10:100735535-100735557 GAGCACACAGCCGTGGCGGCGGG + Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077294599 11:1819958-1819980 CAGCAAACTACAGTCGCCCCCGG - Intergenic
1078340276 11:10493571-10493593 CAGCAGACAGCAGCCCTGGCTGG + Intronic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083950411 11:65952129-65952151 CAGGCAACAGCCGTCGCGCCTGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085015889 11:73173860-73173882 CAGCCAACAGCAGTCCCAGTGGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088606580 11:111539546-111539568 CAGCTAACAGCGGTTGTGGCAGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089748573 11:120634337-120634359 CAGCAAACAGGAGGCGGAGCTGG + Intronic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091581267 12:1791624-1791646 CACCAAACAGCAGTCTCTGTAGG - Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096864774 12:54556013-54556035 CAGAAGACAGGAGTCGGGGCTGG - Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098611883 12:72468756-72468778 CAGCAACAGGCAGTGGCGGCTGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113004179 13:105679755-105679777 CAGCAAACAGCTGTCCCAGGAGG + Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116046055 14:39743739-39743761 CAGCAAACAGCTTTTGGGGCTGG - Intergenic
1117674439 14:58141396-58141418 CAGCAAATATCAGACGCTGCTGG - Intronic
1118502715 14:66378299-66378321 TAGAAAGCAGCAGTCTCGGCTGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119986767 14:79147183-79147205 CTGCACACAGCAGTCACTGCAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1122996919 14:105270013-105270035 AAGCAGACAGCAGGCGGGGCGGG + Intronic
1202939978 14_KI270725v1_random:137015-137037 CCGCAAAAAGTAGTGGCGGCGGG + Intergenic
1202940188 14_KI270725v1_random:137952-137974 CAGCAAAAAGCCGCAGCGGCGGG + Intergenic
1124707618 15:31978493-31978515 CAGGGAACAGCACTCGCGTCGGG - Intergenic
1125029608 15:35063153-35063175 CAGCAGACAGAGGTCGCGGTGGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1128582855 15:68820983-68821005 CAGCCAATGGCAGTGGCGGCGGG + Intronic
1128691428 15:69727264-69727286 CAGAAAACAGCATTGGCTGCTGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1134531808 16:14989597-14989619 CAGCAGCACGCAGTCGCGGCCGG + Intronic
1136696500 16:32085422-32085444 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
1136699192 16:32116436-32116458 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1136711492 16:32240601-32240623 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136756420 16:32688804-32688826 CAACAAACAGAAGTGGCAGCGGG + Intergenic
1136796998 16:33028696-33028718 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
1136799683 16:33059607-33059629 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1136811693 16:33181569-33181591 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136818169 16:33291649-33291671 CAACAAACAGAAGTGGCAGCGGG - Intronic
1136824733 16:33348178-33348200 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136829799 16:33446949-33446971 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136938615 16:34499799-34499821 CAGCAAAAAGCTGTAGCTGCGGG + Intergenic
1136961203 16:34848758-34848780 CAGCAAAAAGCTGTAGCTGCGGG - Intergenic
1137218925 16:46427910-46427932 CCGCAATAAGCAGTGGCGGCAGG + Intergenic
1137610738 16:49815538-49815560 CAGCAAACAGGAGGCAGGGCTGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1202990271 16_KI270728v1_random:4538-4560 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1203058562 16_KI270728v1_random:949158-949180 CAACAAACAGAAGTGGCAGCGGG + Intergenic
1143513122 17:7406622-7406644 CAGCAAACAGCTCTGGCGGCTGG + Intronic
1145327516 17:21843632-21843654 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1145327554 17:21843776-21843798 CAGCAAAAAGCCTTGGCGGCGGG - Intergenic
1145327574 17:21843857-21843879 CCACAAAAAGCAGTGGCGGCGGG - Intergenic
1145694003 17:26773686-26773708 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
1145694153 17:26774315-26774337 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1145694334 17:26774984-26775006 GAGCAAAAAGCCGCCGCGGCGGG - Intergenic
1145694374 17:26775165-26775187 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1152825031 17:82459122-82459144 GAGTAAACAGCGGTCGTGGCGGG + Intronic
1203192169 17_KI270729v1_random:199868-199890 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156528843 18:37795624-37795646 CAGCTACCAGCAGTCCCTGCAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157788394 18:50507371-50507393 CAGGAAACAGCAGCCTAGGCAGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925019535 2:557819-557841 CAGGAAACAGCAGAGGCGTCCGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931110446 2:59105060-59105082 CAGCAAACAGCATTTGGTGCAGG + Intergenic
932238902 2:70142243-70142265 GAGCAAAGAGCCGTCGCGCCCGG - Intergenic
932560509 2:72863351-72863373 CAGCAAACAGGAGACGTGGCTGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933039389 2:77443364-77443386 CAGCAAAAAGCAGTGGCACCAGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
938518288 2:132038255-132038277 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939964979 2:148601417-148601439 CAGCAAAAAGCAGCCGCATCTGG + Intergenic
948481416 2:238252854-238252876 CAGCAAACAGCACACCTGGCAGG - Intronic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
1168776848 20:455144-455166 CAGGAAACAGCAGTCAAGCCAGG - Intronic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174534356 20:51239202-51239224 CAGGAAGCAGCAGCCGCAGCAGG + Intergenic
1175332490 20:58175097-58175119 CAGCAAACAGCAGGCAGGCCGGG + Intergenic
1176583212 21:8550064-8550086 CCGCAAAAAGTAGTGGCGGCGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1180266011 22:10526956-10526978 CCGCAAAAAGTAGTGGCGGCGGG - Intergenic
1180969231 22:19806422-19806444 CAGCCAGCAGCAGTGGCAGCAGG - Intronic
1184074659 22:42168658-42168680 CAGCACAGAGCAGTCGGAGCGGG - Exonic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184457075 22:44616832-44616854 CAGGAAACAAAAGTCGGGGCAGG + Intergenic
1203325057 22_KI270738v1_random:5181-5203 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
949387400 3:3518453-3518475 CAGCTAACTGGAGTCGCGACTGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950443328 3:13022432-13022454 CAGGAGACAGCAGTGGCTGCAGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
953865234 3:46577692-46577714 CAACAAACCCCAGTCGGGGCGGG - Exonic
955475359 3:59330540-59330562 CAACAGACAGCAGGCGAGGCAGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960965256 3:123100057-123100079 CAACAAACAGCAGCTGGGGCAGG - Intronic
962812559 3:138972082-138972104 CGGGAAACCGCAGTCTCGGCTGG + Intergenic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969313555 4:6368271-6368293 CAGCCAGCAGCAGGCGTGGCTGG + Intronic
969869766 4:10097358-10097380 CAGCTAACAGCAGGCCCTGCAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977846483 4:101773458-101773480 CAGCAATCAGCAATTGCAGCAGG + Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984823676 4:183906065-183906087 CTGCAGACAGCAGCTGCGGCGGG - Exonic
985193097 4:187399313-187399335 GAGCAGAGAGCAGTCGCAGCAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991733977 5:69614962-69614984 CAGGGAACAGCAGCCCCGGCTGG + Intergenic
991810411 5:70470103-70470125 CAGGGAACAGCAGCCCCGGCTGG + Intergenic
991860291 5:71007180-71007202 CAGGGAACAGCAGCCCCGGCTGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
998339045 5:141400029-141400051 CAGCAACCAGCAGGCGCTGGCGG - Exonic
999321739 5:150619513-150619535 CTGCAGACAGCAGCCGCTGCAGG - Intronic
1003290880 6:4776917-4776939 CAGCAAACTGCGGCCGCGGCGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004455636 6:15789079-15789101 CAGCAAACAGCATTCACAGCTGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006181257 6:32154654-32154676 CTGCAAGCAGCAGCAGCGGCAGG - Exonic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009338876 6:62529072-62529094 CAGGAAACAGCAGTCGCTCTAGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025306800 7:57868443-57868465 CCGCAAAAAGCAGCGGCGGCGGG + Intergenic
1025307004 7:57869254-57869276 CTGCAAAAAGCAGCGGCGGCGGG + Intergenic
1025320131 7:58087004-58087026 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1025320207 7:58087328-58087350 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1025878560 7:65509899-65509921 CAGCAAAAAGCCGCCGCGGTGGG + Intergenic
1026475064 7:70728086-70728108 GAGAAAACAGCAGTAGCAGCAGG - Intronic
1026625564 7:71988948-71988970 CAGCAAACAGGAGGCACAGCTGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030389304 7:108906168-108906190 CAGCAAGAAGCAGTAGCTGCAGG + Intergenic
1031004194 7:116453465-116453487 CAGCAAAGAGCACTCCAGGCTGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031360083 7:120838847-120838869 CAGCAAACAGCAATCATGACCGG + Exonic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034374168 7:150628409-150628431 CAGGAAACAGCATCCTCGGCAGG - Exonic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048183260 8:132215625-132215647 CAACAAACAGCAGTGGGTGCAGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049047356 8:140163383-140163405 CAGAAAACAACAGTAGCTGCCGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053946121 9:43311653-43311675 CCGCAAAAAGCAGCGGCGGCAGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1203589249 Un_KI270747v1:40211-40233 CCGCAAAAAGCAGCGGCGGCAGG - Intergenic
1203612886 Un_KI270749v1:26637-26659 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1203612989 Un_KI270749v1:27065-27087 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1203613167 Un_KI270749v1:27828-27850 CCGCAAAAAGTAGTGGCGGCGGG - Intergenic
1203616509 Un_KI270749v1:72211-72233 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192314316 X:70040167-70040189 CAGGTAACAGCAGCCTCGGCTGG - Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195975363 X:110520852-110520874 CAACAAACCCCAGTCGGGGCGGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196742327 X:119036090-119036112 CAGCAGACAGTACTCGTGGCAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1200822547 Y:7601858-7601880 AAGCTAAAAGCAGTCGCGGGGGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic