ID: 1171452666

View in Genome Browser
Species Human (GRCh38)
Location 20:25247409-25247431
Sequence CGGGAACAGGGTTTCTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171452654_1171452666 26 Left 1171452654 20:25247360-25247382 CCTTCTCCCTGCTGTAATCTCAA No data
Right 1171452666 20:25247409-25247431 CGGGAACAGGGTTTCTCCGAGGG No data
1171452657_1171452666 19 Left 1171452657 20:25247367-25247389 CCTGCTGTAATCTCAAAGCGGAC No data
Right 1171452666 20:25247409-25247431 CGGGAACAGGGTTTCTCCGAGGG No data
1171452656_1171452666 20 Left 1171452656 20:25247366-25247388 CCCTGCTGTAATCTCAAAGCGGA No data
Right 1171452666 20:25247409-25247431 CGGGAACAGGGTTTCTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171452666 Original CRISPR CGGGAACAGGGTTTCTCCGA GGG Intergenic
No off target data available for this crispr