ID: 1171452840

View in Genome Browser
Species Human (GRCh38)
Location 20:25248027-25248049
Sequence CCGCGCCTGCGCGCCGCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171452840_1171452847 8 Left 1171452840 20:25248027-25248049 CCCGGCGCGGCGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 39
4: 343
Right 1171452847 20:25248058-25248080 GCCCGCAGAGCCGCAGTGCCGGG 0: 1
1: 0
2: 1
3: 26
4: 228
1171452840_1171452851 22 Left 1171452840 20:25248027-25248049 CCCGGCGCGGCGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 39
4: 343
Right 1171452851 20:25248072-25248094 AGTGCCGGGCGCCAGAGCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 177
1171452840_1171452846 7 Left 1171452840 20:25248027-25248049 CCCGGCGCGGCGCGCAGGCGCGG 0: 1
1: 0
2: 7
3: 39
4: 343
Right 1171452846 20:25248057-25248079 CGCCCGCAGAGCCGCAGTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171452840 Original CRISPR CCGCGCCTGCGCGCCGCGCC GGG (reversed) Intergenic