ID: 1171452933

View in Genome Browser
Species Human (GRCh38)
Location 20:25248485-25248507
Sequence CGCCCCGCAGAGACCCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171452933_1171452939 9 Left 1171452933 20:25248485-25248507 CCAGCGGGGGTCTCTGCGGGGCG 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1171452939 20:25248517-25248539 GCGTTACCTGCGCCCCTAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1171452933_1171452940 13 Left 1171452933 20:25248485-25248507 CCAGCGGGGGTCTCTGCGGGGCG 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1171452940 20:25248521-25248543 TACCTGCGCCCCTAGCCGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 44
1171452933_1171452942 16 Left 1171452933 20:25248485-25248507 CCAGCGGGGGTCTCTGCGGGGCG 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1171452942 20:25248524-25248546 CTGCGCCCCTAGCCGGCCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 113
1171452933_1171452944 21 Left 1171452933 20:25248485-25248507 CCAGCGGGGGTCTCTGCGGGGCG 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1171452944 20:25248529-25248551 CCCCTAGCCGGCCGGCGGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171452933 Original CRISPR CGCCCCGCAGAGACCCCCGC TGG (reversed) Intronic
902554836 1:17240782-17240804 AGCCCCGCAGACCCCCCAGCAGG - Intronic
903921614 1:26804052-26804074 CGCCCGGCAGCCACCCCGGCGGG - Intergenic
904642070 1:31938388-31938410 CGCCCCGCAGCGCCCCCTGAGGG - Intronic
904778266 1:32925114-32925136 CCTCCCCCAGGGACCCCCGCGGG - Intergenic
905183012 1:36178180-36178202 CCCCCCGCGGAGACCCCTACAGG + Exonic
906538017 1:46562691-46562713 GGCCCCGCAGTGACCCACGAAGG + Exonic
910597091 1:88992441-88992463 CTCCCTGCAGCCACCCCCGCAGG + Intronic
914780590 1:150781665-150781687 TGCCCGGCCGAGACCCCCTCTGG + Intergenic
919423903 1:197405874-197405896 CGCCCCGCAGCCACCCCGTCTGG + Intronic
922698675 1:227745286-227745308 AGCCCCACAGAGGCCCCTGCAGG + Intronic
923684186 1:236142577-236142599 CGATGCGCGGAGACCCCCGCGGG + Exonic
1066586794 10:36944523-36944545 GGCCCCGCAGTGACCCACGAAGG + Intergenic
1067145420 10:43690233-43690255 CGCCCCGCAGCGCCCTCTGCCGG - Intergenic
1069984658 10:72274912-72274934 CGTCCAGCAGCGCCCCCCGCAGG - Exonic
1072491184 10:95907602-95907624 CGCCCCGCAGCGTCCTCCCCGGG + Intronic
1072986299 10:100143922-100143944 CGCGCAGCTGAGACCACCGCTGG + Intergenic
1072999696 10:100277300-100277322 CGCCCGGCAGCCACCCCGGCCGG + Intronic
1075370119 10:121928287-121928309 CGCCCCGCACAGGCCCTCGGCGG - Intronic
1075430252 10:122374592-122374614 CACGCCGCAGGGACCCGCGCGGG + Intergenic
1076750069 10:132538009-132538031 GGCCCCGCGAAGACCCCGGCCGG + Exonic
1076823983 10:132958098-132958120 CAGCCCGCAGTGACCCCCGGGGG - Intergenic
1076898405 10:133325313-133325335 CTCCCCCCAGGGACCCCCGAAGG - Intronic
1077254076 11:1572779-1572801 CGCCCCGCCGCGACCCCCGCAGG + Intergenic
1080012341 11:27472049-27472071 CGCCCCGCGGCGCCCCCCGCTGG + Intronic
1082065159 11:47893210-47893232 TGCCCCGCCGAGACCCCGTCTGG + Intergenic
1082092840 11:48103926-48103948 CACCCTGCAAAGATCCCCGCTGG - Intronic
1082797351 11:57387767-57387789 GGCCACGCAGTGACCACCGCGGG + Exonic
1084070172 11:66728473-66728495 GGCCCCGCCCAGAGCCCCGCGGG - Intronic
1089421120 11:118331921-118331943 CGCCCGGCAGCCACCCCAGCTGG - Intergenic
1091208016 11:133833915-133833937 CTCCCTGCAGTGACCCACGCAGG + Intergenic
1091304313 11:134527850-134527872 CACCCCCGAGAGACCCCCACTGG - Intergenic
1092263054 12:6962698-6962720 CGCTACCCAGAGACCCCAGCTGG - Intergenic
1095954160 12:47797016-47797038 CGGCCCGCAGAGACCCTCGGAGG - Exonic
1097127100 12:56783835-56783857 CGCCCGGCAGCCACCCCCTCCGG - Intronic
1097872219 12:64610816-64610838 CGCCCCGCAGAGACACGTGGAGG - Intronic
1103414054 12:120732384-120732406 CGCCCAGCAGACACCCCGTCTGG - Intronic
1103564004 12:121806360-121806382 CCCACCGCTGACACCCCCGCGGG + Intronic
1107078288 13:36346700-36346722 GGCCCCGCGCAGACCCCCCCAGG + Exonic
1107692494 13:42966660-42966682 CGCCCGGCAGCCACCCCGGCCGG + Intronic
1113493625 13:110712410-110712432 CGCCCCGCTGCGGCCGCCGCGGG - Intronic
1113848896 13:113407024-113407046 CCCACCGCAGAGAGCACCGCAGG - Intergenic
1113936996 13:113999910-113999932 CCCCTGGCAGAGACCCCCCCCGG - Intronic
1119319190 14:73719265-73719287 GTCCCCGCTGGGACCCCCGCGGG - Exonic
1125598111 15:40900321-40900343 CGCCCTGCAGAGCCCCAAGCCGG - Exonic
1126113330 15:45187858-45187880 CGCCCCGGCGGGACCCCCCCGGG + Intronic
1128537447 15:68501603-68501625 TGTCCAGCAGAGACCCCCCCAGG - Intergenic
1129054146 15:72807269-72807291 CGCCCGGCAGCCACCCCCTCTGG - Intergenic
1129428361 15:75481151-75481173 TGCCCGGCCGAGACCCCCTCTGG + Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1136315921 16:29454749-29454771 GGCCTCGCCGCGACCCCCGCGGG - Exonic
1136430498 16:30194091-30194113 GGCCTCGCCGCGACCCCCGCGGG - Exonic
1136453987 16:30370194-30370216 CGCCCCTCACATCCCCCCGCCGG + Exonic
1139390807 16:66605377-66605399 CGCTCCGCACGGCCCCCCGCCGG - Intronic
1142761032 17:2042050-2042072 GGCCGCGCAGCGACCCCTGCGGG + Exonic
1143115297 17:4578497-4578519 CGCCCCGCAGCCACCCCATCCGG - Intergenic
1144500918 17:15786402-15786424 CTCCCGGCCGTGACCCCCGCTGG + Intergenic
1146329704 17:31917255-31917277 CGCCCTGCCGAGCCGCCCGCGGG - Intergenic
1146750291 17:35373161-35373183 CGCCCCGCAGAAACCGCGGCTGG + Intronic
1147317357 17:39627325-39627347 AGCCCAGCACAGACCGCCGCCGG + Exonic
1148271735 17:46266939-46266961 CGCGCCGCCGAGGGCCCCGCCGG + Intergenic
1149849264 17:60025805-60025827 TGGCCCGGAGCGACCCCCGCCGG - Intergenic
1149860904 17:60120719-60120741 TGGCCCGGAGCGACCCCCGCCGG + Intergenic
1150135537 17:62693023-62693045 CGCCCCACAGCCACCCCAGCAGG - Exonic
1150624884 17:66835290-66835312 CGTCCCCCAGGGACCCCCCCAGG - Intronic
1151301705 17:73231967-73231989 CACCCCACAGGGAGCCCCGCCGG + Intronic
1152628749 17:81400127-81400149 TGCCCCTCCGAGACCCCCGGGGG - Intronic
1152777789 17:82213228-82213250 CGGCCCGAACAGACCCCCACGGG - Intergenic
1160858768 19:1228906-1228928 CGGGCCGCGGAGACCCCGGCTGG - Exonic
1161053667 19:2179112-2179134 TGCCACACAGAGACCCCAGCTGG - Intronic
1161087876 19:2343480-2343502 CGCCCCGCAGCCACCCACCCAGG - Intronic
1161264783 19:3359315-3359337 CGCTCCGCAGCGAGCCCAGCCGG + Intergenic
1161411042 19:4117626-4117648 TGCCCTGCAGAGACCCCCCAGGG + Exonic
1162032947 19:7925216-7925238 GGCCCCGCGGCGCCCCCCGCCGG + Exonic
1162051054 19:8033371-8033393 CGCCCCCCAAAAACCCCCACCGG + Intronic
1162953474 19:14085520-14085542 CGCCCTGCGGAGACCCCTCCAGG - Exonic
1163729580 19:18941290-18941312 CGCCCCGCTGCGCCCCCTGCCGG + Intergenic
1164594912 19:29526373-29526395 CCCCGCGCAGCGCCCCCCGCCGG + Intergenic
1167251038 19:48398514-48398536 CGCCCCGCCGAGGCCGCCGCCGG - Exonic
926678850 2:15649145-15649167 TGCCCTGCAGGGACCTCCGCAGG + Intergenic
928428834 2:31201386-31201408 CGCCCCACAGGGACCCAAGCAGG + Intronic
928558112 2:32447852-32447874 CGCCCGGCAGCGACCCCGTCCGG - Intronic
930665583 2:54096071-54096093 CGCCCCGCAGCCACCCCGTCCGG - Intronic
932036414 2:68251816-68251838 CGCCCGGCATCGACCCCCGCGGG - Intronic
932288159 2:70553931-70553953 CGCCCCGCAGCGCTGCCCGCCGG + Exonic
932495680 2:72144737-72144759 CGCCCTGCAGAGTCCTCCGAGGG - Intronic
933658062 2:84905518-84905540 CGCCCTGCCGCGCCCCCCGCTGG - Intronic
934176997 2:89585120-89585142 GGCCCTGCAGGGACCCCCCCCGG - Intergenic
934287304 2:91659479-91659501 GGCCCTGCAGGGACCCCCCCGGG - Intergenic
934703456 2:96461629-96461651 CGCCCCGCAGCCACCCCATCTGG + Intergenic
934846473 2:97664030-97664052 CGCCCTCCAGAAAGCCCCGCGGG - Exonic
943773390 2:191742015-191742037 CGCCCGGCAGCCACCCCGGCCGG + Intergenic
944263121 2:197696529-197696551 CGCCCGGCAGCCACCCCCTCCGG - Intronic
947523339 2:230864801-230864823 GGGCCCGCAGTGACCCCTGCCGG - Intronic
948047059 2:234952500-234952522 CACCCCGCAGGGCCGCCCGCCGG - Intronic
948892931 2:240915983-240916005 CACCCCGCAGAGGCCCCGGGCGG + Intergenic
948993926 2:241568997-241569019 AGCCCAGCAGTGATCCCCGCAGG - Intronic
1168800834 20:642446-642468 GGCCCCGCGGAGCCCCCTGCGGG + Intergenic
1171452933 20:25248485-25248507 CGCCCCGCAGAGACCCCCGCTGG - Intronic
1172702676 20:36862872-36862894 TGCCCCGTACGGACCCCCGCCGG + Exonic
1173741644 20:45406332-45406354 CGCCCCGCGCAGACCCGCGGCGG - Intronic
1173827746 20:46058210-46058232 CTCCCCGCAGTGCCCCCAGCGGG - Intronic
1173864913 20:46307614-46307636 CGGCCCACAGGGACCCCTGCCGG - Intronic
1176171831 20:63699670-63699692 GGCCCCACAGAGAACCCCTCCGG + Exonic
1178585245 21:33865942-33865964 CGGCCAGCAGAGACCCACACTGG - Intronic
1179512034 21:41879437-41879459 CGCCCCGCAGTCCCACCCGCAGG - Exonic
1179921081 21:44507922-44507944 CCCCCAGCAGACACCGCCGCTGG + Intronic
1183279627 22:36924911-36924933 CACTCTGCAGAGACCCCCTCAGG + Intronic
1183294073 22:37019605-37019627 CGTCCCCCTCAGACCCCCGCGGG - Intronic
1183343983 22:37296761-37296783 CTACCCACAGAGACCCCCGCAGG + Intronic
1184111458 22:42398005-42398027 CTCCCCGCACAGACCCCCCAGGG + Intronic
1184155264 22:42662775-42662797 CTCCCCGCAGAGCTCCCAGCTGG + Intergenic
1185162269 22:49237087-49237109 GGCCCAGCAGAGACTCCGGCCGG + Intergenic
1185381298 22:50508478-50508500 CGCCCCGCAGCCCCACCCGCCGG - Intronic
950630550 3:14279101-14279123 CGCCCCTCAGAGTCCTCCCCAGG - Intergenic
951558743 3:23945646-23945668 CGCCCCCCAAAGTGCCCCGCGGG - Intronic
957959057 3:87226784-87226806 CGCACCGCGCAGACCCCTGCAGG - Intergenic
960817558 3:121688983-121689005 CGCCCGGCAGCCACCCCCTCCGG + Intronic
961215401 3:125156063-125156085 GGCCAGGCAGAGACCCCAGCCGG + Intronic
962498416 3:135965706-135965728 CGCCCCGCCCAGCCACCCGCAGG - Exonic
962875942 3:139536157-139536179 CGGCCCTCAGAGAGCCCAGCTGG + Intronic
963249072 3:143086746-143086768 CGCCCCGCAGCCACCCCGTCCGG - Intergenic
967054802 3:185823259-185823281 TGCCCCCCCTAGACCCCCGCGGG - Intronic
968093015 3:195909694-195909716 CGCCCCGCGCCGGCCCCCGCAGG + Intronic
969559768 4:7939598-7939620 CCCGGGGCAGAGACCCCCGCCGG + Exonic
970216092 4:13761283-13761305 CGCCCGGCAGCCACCCCCTCTGG - Intergenic
975908890 4:79245737-79245759 CGCCCGGCAGCCACCCCCTCTGG + Intronic
984474139 4:180215681-180215703 CACCCTGCAGAGAGCCCTGCTGG + Intergenic
985783504 5:1882567-1882589 CGCCCCGCCCAGGCCACCGCAGG - Intronic
990347426 5:54884065-54884087 CGCCCCGCAGAACCCCAGGCAGG + Intergenic
995462624 5:112419521-112419543 CGGCCTGCGGAGTCCCCCGCGGG + Intergenic
995724577 5:115169921-115169943 CGCCGCGCAGAGACCTGGGCGGG + Intronic
1006128516 6:31854525-31854547 CGCCCCGCAGCCACCCCATCTGG - Intergenic
1008919249 6:56824843-56824865 CGCCCCGCAGCCACCCCGTCCGG + Intronic
1010245958 6:73660816-73660838 CGCCCGGCAGCCACCCCCTCCGG - Intergenic
1010400594 6:75441952-75441974 CGCCCCGCAGCCACCCCGTCCGG - Intronic
1012428701 6:99142174-99142196 CGCCCGGCAGCCACCCCCTCTGG + Intergenic
1017324579 6:153130965-153130987 CGCCGCGCAGCCGCCCCCGCCGG + Intronic
1019536296 7:1531253-1531275 CGCCCCGCCCCGCCCCCCGCAGG - Intronic
1020099863 7:5388760-5388782 CCCCCCGCGGCCACCCCCGCCGG - Exonic
1020125819 7:5531958-5531980 CGCGCTGCAAAGAGCCCCGCAGG - Intronic
1024579817 7:50792934-50792956 CGCAGCGCGGAGAGCCCCGCGGG + Intronic
1029496051 7:100895904-100895926 CCCCCCGCACACACCCCCTCCGG + Exonic
1035476291 7:159145727-159145749 CGCCCCGCCGCGCCCCACGCGGG + Intergenic
1041026607 8:53693211-53693233 AGCCCAGCAGAGAGCACCGCAGG + Intergenic
1042039382 8:64576451-64576473 CCCACCGCGGAGACCCCAGCTGG - Intergenic
1048416185 8:134230068-134230090 AGCCCCACAAAGACCCCCACAGG - Intergenic
1049283117 8:141760602-141760624 CGCGGCGCCGAGACCCCCTCGGG + Intergenic
1049396366 8:142402989-142403011 CGCCACGCCGCGGCCCCCGCCGG + Intronic
1049617911 8:143583994-143584016 CTCCCCGCAGAGACACCAGAAGG + Intronic
1059208440 9:112487348-112487370 CGAGGCGCAGAGACCCCCGGTGG + Intronic
1062097040 9:134708860-134708882 CGGCAGGCAGAGTCCCCCGCTGG - Intronic
1062427475 9:136512602-136512624 CGGCCCCCAGAGACCCCAGCAGG + Intronic
1190322319 X:49186422-49186444 CGCCCCGCAGGGCCCGCCCCCGG + Intronic
1200080348 X:153573139-153573161 CGGCCCGGAGGGACCCCCGGTGG - Intronic