ID: 1171456659

View in Genome Browser
Species Human (GRCh38)
Location 20:25276289-25276311
Sequence CAGAGGGTAAGGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1484
Summary {0: 1, 1: 1, 2: 10, 3: 116, 4: 1356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171456659 Original CRISPR CAGAGGGTAAGGAGGGAGGT GGG Intronic
900084031 1:878528-878550 GAGGGGGTAAAGAGGGAGTTGGG - Intergenic
900295879 1:1949154-1949176 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
900381678 1:2387291-2387313 CAGAGGGTTGGAAAGGAGGTAGG - Intronic
901051291 1:6427010-6427032 AAGAGGGCACGGAGGGAGCTGGG - Intronic
901406713 1:9052776-9052798 CAGAGGCCAAGGTGGGAGGATGG + Intronic
901470899 1:9455889-9455911 CAGAGGCTCAGGAGAGGGGTCGG - Intergenic
901624659 1:10617223-10617245 CAGAGGGCAAGAAGGGAGTGGGG - Intronic
901667529 1:10835170-10835192 AAGAGGGGAAGGAGGGGGCTTGG + Intergenic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
902036551 1:13462429-13462451 GGGAGGGTAAGGTGGGAGGATGG - Intergenic
902204782 1:14860151-14860173 GAGAGAGAAAGGAGGGAGGGAGG - Intronic
902283039 1:15388320-15388342 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
902515229 1:16986417-16986439 CAGCGGGAGAGAAGGGAGGTGGG - Intronic
902795331 1:18797187-18797209 CAGAGGTTAAGGATGGTTGTGGG + Intergenic
902833101 1:19030173-19030195 CAGAAGGGAAGGAGGGAGGGAGG + Intergenic
902917356 1:19646641-19646663 CAGAGGGTGTGGAGGGTGGCTGG - Intronic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903103219 1:21052532-21052554 GAGAGGGAGAGGAGGGAGCTAGG - Intronic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
903614199 1:24640413-24640435 CAGAGGTTGAGGTGGGAGGATGG + Intronic
903979593 1:27176321-27176343 CAAAGTGTGAGGAGGGAGGTGGG + Intergenic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904497615 1:30895904-30895926 GAGATGGAGAGGAGGGAGGTTGG + Intronic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904807478 1:33142123-33142145 CAGAGGGCTAGGAGGGAGGTGGG - Intergenic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
904876897 1:33662336-33662358 CAGGGAGCAAGGAGGGATGTGGG - Intronic
905105957 1:35563734-35563756 AAGGGGGGAAGGATGGAGGTAGG - Intronic
905313562 1:37066838-37066860 AAGAGGGGAATGAGGGAGGAAGG - Intergenic
905341632 1:37282313-37282335 AAGAGGGGAGGGAGGGAGTTTGG + Intergenic
905370200 1:37478995-37479017 GAGAAGCTAGGGAGGGAGGTGGG - Intronic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
906501240 1:46342878-46342900 CAGAGAGGCAGGAGGGAGGTGGG - Intronic
906969397 1:50495257-50495279 CAGAGGCTAGGGAGGGCAGTGGG - Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907437497 1:54458968-54458990 CAGGCGGGAAGGAGGGAGGGAGG + Intergenic
907774429 1:57499370-57499392 GAGAGGTAAGGGAGGGAGGTTGG + Intronic
907828625 1:58042571-58042593 CAAAGGAAAAGGAGGGAGATGGG + Intronic
908356557 1:63329080-63329102 CAGAGGGCAAGGAGGGGGAGTGG - Intergenic
908793710 1:67810240-67810262 CAAAGGGTTAGGAGGGAGAGAGG + Intronic
909607624 1:77522598-77522620 GAGAGGGTGGGCAGGGAGGTGGG - Intronic
910030772 1:82719967-82719989 TAGGGGGTTGGGAGGGAGGTGGG - Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910346785 1:86248043-86248065 CAGAATGTAATCAGGGAGGTAGG - Intergenic
910491900 1:87781910-87781932 CAAATGCTAAGGAGGGAGGAAGG - Intergenic
910572431 1:88720773-88720795 CAGAGGGAAAGGTGGGAGTGGGG - Intronic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910836556 1:91518723-91518745 CAGAGGCTGAGAAGGGTGGTGGG + Intronic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
912548941 1:110471870-110471892 CAGAGGGGAAGGGGAGAGGGAGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913147487 1:116006654-116006676 GAGAAGGAAAGGAGGGAGGGAGG - Intronic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
913395790 1:118370400-118370422 GAGAGAGGAGGGAGGGAGGTGGG - Intergenic
913484940 1:119325768-119325790 CACAGGGTAAGGTAGGAGGTTGG + Intergenic
914197861 1:145459202-145459224 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
914476964 1:148032326-148032348 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
914814265 1:151051897-151051919 CAGAGGGCAAGAATGGAGGAGGG + Exonic
915073805 1:153293077-153293099 CAGAGGGTAAGGGGGAAGGATGG + Intergenic
915100693 1:153497197-153497219 AGGAAGGTGAGGAGGGAGGTTGG - Intergenic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915449446 1:155994526-155994548 CACAGGGAAGGGAGGGAGGCAGG + Intronic
915513923 1:156401845-156401867 CAGAGGGAAGGGGAGGAGGTGGG + Intergenic
915517504 1:156421734-156421756 CAGAGGCAGAGGAGGGAGCTAGG - Intronic
915546116 1:156598916-156598938 CAGATGGTAGGCAGGGAGCTGGG + Intronic
916104071 1:161418025-161418047 GAGAAGGGAGGGAGGGAGGTAGG + Intergenic
916407401 1:164510982-164511004 CAGAGGGGAAGGTGAGAGGAAGG - Intergenic
916463915 1:165054153-165054175 GTGAGGGTAGGGAGGGAGTTGGG - Intergenic
916654757 1:166864794-166864816 CAGGGGGTTAGAAGGAAGGTGGG + Intronic
916802969 1:168231714-168231736 GAGAGGGGAATAAGGGAGGTGGG + Intronic
916872668 1:168933990-168934012 CAGAGGAAAGGGCGGGAGGTCGG - Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917019104 1:170567177-170567199 AAGACGGTAAGGAGGGAGGGAGG + Intergenic
918234677 1:182569356-182569378 TTGAGGGAAAGGAGGGAGGGGGG - Intergenic
918373695 1:183887183-183887205 AGGAGGGGAAGGAGGGAGGGAGG - Intronic
919074295 1:192795210-192795232 CACAGGCTAAGGTGGGAGGATGG + Intergenic
919333026 1:196195314-196195336 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
920309283 1:205039129-205039151 CAGAGGATGAGGAGAGAGGGAGG - Intergenic
920317721 1:205090863-205090885 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
920363757 1:205437155-205437177 CAGAAGGCAAGGAATGAGGTGGG + Intronic
920368271 1:205460081-205460103 CAGAGCCTAAGGAGGGGAGTGGG + Intergenic
920375442 1:205505507-205505529 CAGAGGGAAAGGAGGCTGGGTGG + Intronic
920739736 1:208569150-208569172 CAGAGGCTGGTGAGGGAGGTGGG + Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921293870 1:213683841-213683863 CCCAGGGTGAGGAGGGAGGGAGG - Intergenic
921371003 1:214423135-214423157 AAGAGGGAAAGGGGGGAGGGAGG + Intronic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921661413 1:217807252-217807274 AAGAGGGGAGGGAGGGAGGGAGG + Intronic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
922541574 1:226424155-226424177 CAGAGGTTGAGGTGGGAGGATGG + Intergenic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922956149 1:229602388-229602410 CAGATGGTAGTGAGGGAGGGAGG + Exonic
923306377 1:232692566-232692588 AAGAGGGTAGGCAGTGAGGTAGG + Intergenic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923688783 1:236173412-236173434 GAGAGAGGAAGGAGGGAGGGAGG + Intronic
923975057 1:239253441-239253463 CAGAGCGTACGCAGTGAGGTTGG + Intergenic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
924091608 1:240507320-240507342 GAGAGGTAAAGGAGGGAGGGAGG - Intronic
924234401 1:241988553-241988575 GAGAGAGAAAGGAGGGAGGGAGG - Intergenic
924576332 1:245284034-245284056 GAGAGGGAAAGGAGGGATGAGGG - Intronic
1062818430 10:516817-516839 CAGGGGGTAGGGTGGGAGGGGGG + Intronic
1063049446 10:2430861-2430883 CGGAGGGAAGGGAGGGAGGGAGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063513513 10:6670951-6670973 CAGTGGGTAAGGCAAGAGGTTGG + Intergenic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1064585556 10:16836567-16836589 CAGAGGGGCAGGAGGAAGGGAGG + Intronic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1064741540 10:18439788-18439810 CAGAAGGGAGGGAGGGAGGAAGG - Intronic
1065013268 10:21438778-21438800 GAGAGGCTAAGGTGGGAGGATGG - Intergenic
1065020264 10:21496733-21496755 CAGAGGGTACGGTGGGGGGCGGG - Exonic
1065356105 10:24843220-24843242 GAGAGGCTAAGGTGGGAGGATGG + Intergenic
1065531625 10:26675885-26675907 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1065765635 10:29026941-29026963 AAGAAGGAAGGGAGGGAGGTAGG + Intergenic
1065780227 10:29160397-29160419 CAGAGGGGTAGGAGAGAGGAGGG + Intergenic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1065901837 10:30214912-30214934 CCCAGAGTAAGGAGGGAGGAGGG - Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1066166794 10:32797514-32797536 CAAAGGGTAGGGAGGGAGTAAGG + Intronic
1066220658 10:33334714-33334736 GGGAGGGGGAGGAGGGAGGTAGG + Exonic
1066265071 10:33768804-33768826 CAGAGGCTAAGGTGAGAGGATGG + Intergenic
1067060121 10:43073982-43074004 CACAGGGAAGGGAGGGAGGAGGG - Intergenic
1067218844 10:44326838-44326860 CAGAGGGGAAGGTGTCAGGTTGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067833221 10:49622027-49622049 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
1068467498 10:57413654-57413676 CAGAGGCTAAGACAGGAGGTTGG - Intergenic
1068542432 10:58310336-58310358 CAGAGGCTAGGAAGGGAAGTGGG + Intergenic
1069088907 10:64175718-64175740 CACAGTGTAGGGAAGGAGGTGGG - Intergenic
1069258245 10:66361330-66361352 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
1069642099 10:69962732-69962754 CTGAGAGGAGGGAGGGAGGTGGG - Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1069900165 10:71702370-71702392 CTGAGGGAACGGAGGGAGCTGGG + Intronic
1070129382 10:73646552-73646574 TAGAGAGTGAGGAGGAAGGTGGG + Exonic
1070628967 10:78070871-78070893 CAGAAATTAAGGAGGAAGGTGGG - Intergenic
1070660177 10:78300030-78300052 CAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1070753365 10:78976796-78976818 CAGAGGGAAAGAAGAGATGTTGG - Intergenic
1070976417 10:80609334-80609356 CAGAGGGGAAGGAAAGAGGAAGG - Intronic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071147923 10:82597043-82597065 CATATGGTAAGGAGGGAGAAGGG - Intronic
1071541127 10:86485090-86485112 TAGATGGGAAGGAGGGGGGTAGG - Intronic
1071571152 10:86698087-86698109 CAGAGGTTAAGGAGGTGGGTGGG - Intronic
1071729899 10:88237292-88237314 AAGAGGGAAGGGAGGGAGGGAGG - Intergenic
1071952220 10:90716905-90716927 CAGAGGGAAAGAAGTGAGGCTGG + Intergenic
1072172418 10:92878467-92878489 CAAAGGGTAAGGAGGGCACTGGG - Intronic
1072521295 10:96232197-96232219 CAGCGGGGCAGGAGGGAGCTGGG - Intronic
1072983816 10:100122103-100122125 AAGAGGGGAGGGAGGGAGGGAGG + Intergenic
1073108334 10:101046216-101046238 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1073176659 10:101561134-101561156 CAGAGAGGAAGGACTGAGGTTGG - Intergenic
1073348215 10:102800430-102800452 CAGAGGGCAAGGAGGTAGTCTGG + Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1074065342 10:110008164-110008186 CAGAGGGTAGGGCGGGAGAAGGG - Exonic
1074532599 10:114307174-114307196 CAGAGGGTATGGGTGCAGGTAGG - Intronic
1074729698 10:116356373-116356395 AAGAGGGGAGGGAGGGAGGAAGG + Intronic
1074847178 10:117408604-117408626 CAGAGGCTTAGGAGGGAGCATGG + Intergenic
1074957786 10:118409363-118409385 CAGAGGCAAAGGATGGAGGGAGG + Intergenic
1075178407 10:120187197-120187219 CTGAGTGTAAGCATGGAGGTGGG + Intergenic
1075244791 10:120811320-120811342 CAGAGAGGAAGGAGAGAGGTGGG - Intergenic
1075317736 10:121466022-121466044 AAGAGGGGAGGGAGGGAGGGAGG + Intergenic
1075421972 10:122308603-122308625 AAGCAGGGAAGGAGGGAGGTTGG - Intronic
1075730351 10:124631971-124631993 CAGAGGGTAGGTAGGAAGGAAGG + Intronic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076151471 10:128165494-128165516 AAGAGGGAAAGGAGGTGGGTGGG + Intergenic
1076466642 10:130687365-130687387 CAAAGGCTGAGGAGGCAGGTAGG + Intergenic
1076773341 10:132679140-132679162 CACAGGGAGATGAGGGAGGTGGG + Intronic
1076855485 10:133113735-133113757 GAGAGGGCAAGGATGGGGGTGGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077420800 11:2449003-2449025 CAGGGGATCAGGAGGGTGGTAGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077659113 11:4051038-4051060 GAGAAGGTAGGAAGGGAGGTGGG + Intronic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078715335 11:13834197-13834219 CAGAGGGGAAGAAGGGAATTGGG - Intergenic
1078935411 11:15945192-15945214 TAGAGGGTAAGGAGGGATATAGG + Intergenic
1080557417 11:33430183-33430205 GGGAGGGAAAGAAGGGAGGTAGG - Intergenic
1080708193 11:34719349-34719371 CAGATGTTAAGTAGGCAGGTGGG + Intergenic
1080746265 11:35111329-35111351 CAGAGGGAAAGGAGCCAGCTAGG - Intergenic
1080990084 11:37522220-37522242 CAGAGGCTAAGAAGGGTAGTTGG + Intergenic
1081091510 11:38872751-38872773 AAGAGGGTAGGGTGGGAGGGAGG - Intergenic
1081105369 11:39060892-39060914 CAGAGGGTGAGAAGGGTAGTGGG - Intergenic
1081615979 11:44591459-44591481 CAGAGGGCAAGGAGGAGGCTGGG - Intronic
1081659553 11:44879645-44879667 AACAGGGTGAGGAGGGTGGTCGG + Intronic
1082009875 11:47442627-47442649 CAGCGGGGAAGGGGGCAGGTCGG - Intronic
1082038716 11:47667172-47667194 CAGAGGGTATGGTGGGAGTGTGG + Intronic
1082728246 11:56763590-56763612 CAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1082812882 11:57489225-57489247 GAGAGGGGAAGGATGAAGGTGGG + Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082849849 11:57754834-57754856 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1082881681 11:58044299-58044321 CACCAGGTAAGGAGGGAGGCTGG - Intronic
1083201990 11:61126226-61126248 CAGAGGTGATGCAGGGAGGTCGG - Intronic
1083212922 11:61200200-61200222 CAGATGGAAGGGAGGGAGCTTGG - Intergenic
1083215866 11:61219366-61219388 CAGATGGAAGGGAGGGAGCTTGG - Intergenic
1083275309 11:61593787-61593809 AGGAGGCTAAGGCGGGAGGTGGG - Intergenic
1083332249 11:61904400-61904422 CACAGGGCAAGGAGGCAGTTTGG - Intronic
1083495376 11:63047551-63047573 GTGAGGGTAAGGTGTGAGGTTGG - Intergenic
1083737114 11:64687651-64687673 GAGGAGGGAAGGAGGGAGGTGGG + Intronic
1083793469 11:65000906-65000928 GAGAGAGAAAGGAGGGAGGGAGG - Intergenic
1083993557 11:66261082-66261104 GAGAGAGCAAGAAGGGAGGTTGG + Intronic
1084572743 11:69969285-69969307 CAGAGGCTGAGAAGGGTGGTAGG + Intergenic
1084652241 11:70496003-70496025 CAGAGGCTAAGGTGGCAGCTGGG + Intronic
1084793983 11:71491975-71491997 CCTGGGGTCAGGAGGGAGGTAGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085076106 11:73594211-73594233 CAGATACTCAGGAGGGAGGTGGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085325965 11:75606801-75606823 CAGAGCTAGAGGAGGGAGGTTGG - Intronic
1085338585 11:75716780-75716802 CAGTGGGGCAGAAGGGAGGTGGG + Intergenic
1085391692 11:76185459-76185481 CAGGGAGGCAGGAGGGAGGTCGG - Intergenic
1085498921 11:76999620-76999642 CAGGGAGTGAGGAGTGAGGTGGG - Intronic
1085532229 11:77198653-77198675 CAGAGGGGAAGGAGAGGGGCTGG + Intronic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1086302177 11:85438843-85438865 CAGAGGGTAGAGATAGAGGTGGG - Intronic
1086420699 11:86634348-86634370 CAGGATGTCAGGAGGGAGGTTGG - Intronic
1086817747 11:91394233-91394255 CAGAGGGTCAGAGGTGAGGTAGG - Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087119456 11:94558468-94558490 CACAGGATAAGATGGGAGGTTGG + Intronic
1087532338 11:99400170-99400192 CAGAGGCTAAGAAGGGTAGTGGG - Intronic
1087671359 11:101111220-101111242 GAGAGGCTAGGGAGGGAGGTTGG - Intronic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1088116035 11:106315916-106315938 CAGAGAGGAAGGAGGGGAGTTGG - Intergenic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088394878 11:109355873-109355895 AAGAAGGGAAGGAGGGAGGGTGG - Intergenic
1088444423 11:109909410-109909432 GAGAGGGTGAGGTGGGAGGATGG - Intergenic
1088472720 11:110203354-110203376 CAGAGGGTAAGAAGGGTAGTGGG + Intronic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1088818427 11:113437061-113437083 CAGCTGGTAGGGATGGAGGTGGG + Intronic
1088831572 11:113540984-113541006 AAGAGGGTAAAGAGGCAGGTAGG + Intergenic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089528717 11:119113134-119113156 CAGAGGGGAAGCTGGAAGGTAGG - Intronic
1089627938 11:119763223-119763245 CAGAGTGTAAGGTGGGAGGCGGG - Intergenic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089820146 11:121218259-121218281 AAGAGGGGAAGGAGAGAGGGAGG + Intergenic
1090093722 11:123723689-123723711 CTGAGCGTGAGCAGGGAGGTTGG - Intergenic
1090343265 11:126044740-126044762 CAGAAGGGCAGCAGGGAGGTGGG + Intronic
1090407536 11:126486124-126486146 CAGAGTGGAGGAAGGGAGGTGGG + Intronic
1090611813 11:128478257-128478279 AAGAAGGAAAGGAGGGAGGAAGG + Intronic
1091268290 11:134287803-134287825 CAGAGGGTGAGGCGGGAAGGAGG + Intronic
1091285781 11:134408154-134408176 AAGCGGGTGAGGAGGGAGGTGGG + Intronic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1092257316 12:6934400-6934422 CAGAGGGTAACGGTGGAGCTCGG + Intronic
1092391381 12:8083059-8083081 GAGAGGTTAAGAAGGGAGGTAGG - Intronic
1092702908 12:11252909-11252931 CAGAAAGTCAGGAGGGAGATTGG - Intergenic
1092937662 12:13379123-13379145 CAGAGGAAATGCAGGGAGGTGGG - Intronic
1092941379 12:13410373-13410395 CAGAGACAAAGGAGGGAGGTGGG + Intergenic
1093038789 12:14356427-14356449 GAGAGAGAAAGGAGGGAGGGAGG - Intergenic
1093097255 12:14985583-14985605 CACAGGCTACGGAGGGAGGGTGG - Intergenic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1093696549 12:22166982-22167004 CAGAAGGTTAGGATAGAGGTGGG - Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1093989371 12:25572807-25572829 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1094234795 12:28151455-28151477 AAGAGGGGAAGGTGGGAGGTGGG - Intronic
1094319217 12:29167361-29167383 AAGAAGGAAAAGAGGGAGGTTGG - Intronic
1094435625 12:30417968-30417990 CTGAGGGTGAGGAGTCAGGTGGG + Intergenic
1094471555 12:30806236-30806258 CCGAGGGTAAAGAGAGAGCTAGG + Intergenic
1095347593 12:41169649-41169671 CAGAGGGAAAATAGGGAGATAGG + Intergenic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096051133 12:48609099-48609121 CAGGGGGTGAGGTGGGGGGTGGG - Intergenic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096411505 12:51379922-51379944 CACAGGGTAAGGAGGGAGTCGGG + Intronic
1096497378 12:52046217-52046239 CAGAGGGTAGGGGTGGAGATGGG - Intronic
1096764135 12:53869160-53869182 GAGAGGGGAAGGAGGGAGAGGGG - Intergenic
1097147516 12:56951892-56951914 CAGGAGGTAATGAAGGAGGTGGG + Exonic
1097269576 12:57765802-57765824 CAAAGGATAAGGAGGTAGGCGGG + Intronic
1097638337 12:62148542-62148564 AAGAGGGGAAGGAGGAAGGAGGG + Intronic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098332793 12:69372477-69372499 CAGAGGGTAGGAAGGGTAGTGGG - Intronic
1098456934 12:70685114-70685136 CATAGGGAAAGGAGAGAGATGGG - Intronic
1098460799 12:70731050-70731072 CAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098565404 12:71929641-71929663 CAGAGGGTGGGAAGGGTGGTGGG + Intergenic
1100361909 12:93886938-93886960 CAGAGAGTGAGGTGGGAGGCTGG + Intronic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1100742878 12:97614736-97614758 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1100985913 12:100201536-100201558 AAGAAGGAAAGGAGGGAGGAAGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1101718276 12:107330171-107330193 GAGAGGGTAGGGAGGGAGCCTGG + Intronic
1101850885 12:108401280-108401302 GGGAGGCTAAGGAGGGAGGCTGG - Intergenic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102150762 12:110688090-110688112 CAGAGGGGCAGGACGGAGGGTGG + Exonic
1102637558 12:114337344-114337366 GAGAGGGGAGGGAGGGAGGGAGG - Intergenic
1102851209 12:116246836-116246858 GGGAGGGAGAGGAGGGAGGTGGG + Intronic
1103366802 12:120389672-120389694 GAGAGAGGAAGGAGGGAGGGAGG + Intergenic
1103366816 12:120389716-120389738 GAGAGAGGAAGGAGGGAGGGAGG + Intergenic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103667979 12:122586017-122586039 GAAAGGGAAAGGAGGGAGCTGGG + Intronic
1103831126 12:123780135-123780157 GAGAGAGAAAGGAGGGAGGGAGG - Intronic
1103861755 12:124020942-124020964 GAGAAGGAAAGGAGGGAGGCTGG + Intronic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104191095 12:126482487-126482509 GAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104253312 12:127117229-127117251 CAGAGGGAAAGGAGGCAGTGGGG - Intergenic
1104403728 12:128499545-128499567 CAGAGGCTAAGAAGGGTAGTCGG - Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104506702 12:129338976-129338998 GAGAGAGAAAGGAGGGAGGGAGG + Intronic
1104509634 12:129365688-129365710 CAGAGGGCGAGGAGGCAGGCAGG + Intronic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105346976 13:19582346-19582368 CAGAGGCTGAGAAGGGTGGTGGG - Intergenic
1105487724 13:20853401-20853423 GAGAGGCTGAGGTGGGAGGTGGG + Intronic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1106363158 13:29050937-29050959 GAGAGAGGAAGTAGGGAGGTGGG + Intronic
1106792521 13:33169993-33170015 CAGAGGCTGAGGAGGGTAGTGGG + Intronic
1106925646 13:34610250-34610272 TAGAGGGAAAGGATGGAAGTGGG + Intergenic
1107133247 13:36919335-36919357 CAGAGGGGAGGGGGCGAGGTGGG - Intronic
1107367130 13:39693272-39693294 AAGAGGGAAAGGAGGGAGAAAGG - Intronic
1108046422 13:46388231-46388253 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108287570 13:48923766-48923788 CAGAGGCAAAGAAAGGAGGTTGG - Intergenic
1108911402 13:55556468-55556490 GAGAGAGTAAGGAGGGAGGGAGG - Intergenic
1109147706 13:58801852-58801874 GAAAGGGGAACGAGGGAGGTAGG + Intergenic
1109162406 13:58991978-58992000 CACAGGGTGAGACGGGAGGTTGG - Intergenic
1109181531 13:59219961-59219983 CAGAGGGGAGGAAGGGAGGAAGG + Intergenic
1109214489 13:59572427-59572449 CAGAGACTAAGGAGGGAGGGTGG + Intergenic
1109671316 13:65612212-65612234 CAGAAGGGAGGGAGGGAGGGAGG + Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110290879 13:73805603-73805625 CAGAAGGAAGGGAGGGAGGGAGG + Intronic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1110473356 13:75885538-75885560 CAGAGGCCAAGGAGGGTGGACGG - Intergenic
1110783238 13:79491110-79491132 CAGGGAGAAAGAAGGGAGGTAGG - Intronic
1110806371 13:79758790-79758812 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1111514743 13:89314211-89314233 AGGAAGGGAAGGAGGGAGGTAGG + Intergenic
1111745968 13:92270046-92270068 GGAAGGGTAAGGAGGGTGGTGGG + Intronic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1112246585 13:97740654-97740676 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1112434756 13:99383891-99383913 CAGAGAGTAGAGAGGCAGGTGGG - Intronic
1112441419 13:99427097-99427119 CGGAGGGTAGGGTGGGAGGGAGG + Intergenic
1112480046 13:99766961-99766983 CAGAGGCAAAGCAGGGAGGTGGG - Intronic
1112563947 13:100536596-100536618 CAGAGAGAAAAGAGGGAGTTAGG - Intronic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112883127 13:104133971-104133993 CAGAGTGTAAAGAAGGAGATGGG + Intergenic
1113510869 13:110853831-110853853 CAGGGGGTAAGGAGGGCGCCTGG + Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1114007696 14:18332552-18332574 CAGAGGGGAAGAGGGGAGTTTGG - Intergenic
1114658513 14:24330340-24330362 CAGAAGGGTAGGAGGGAGTTGGG + Intronic
1114773562 14:25455969-25455991 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1115013273 14:28577013-28577035 CAGGGGGAAAGGTGGGAGGGAGG + Intergenic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115702841 14:35972230-35972252 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117548678 14:56812588-56812610 CAGAGGGGAAGGCCGGAGGAAGG + Intergenic
1117762849 14:59050294-59050316 GAGAGGGGAAGAAGGGATGTAGG - Intergenic
1118227122 14:63912249-63912271 AAGAAGGAAAGGAGGGAGGAAGG + Intronic
1118405277 14:65416886-65416908 CAGAGGCTAAGGCGGGAGAATGG - Intronic
1118687535 14:68306046-68306068 CAGAGGGGAGGGACGGATGTGGG - Intronic
1118781706 14:69012960-69012982 CACTGGTTTAGGAGGGAGGTGGG - Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118888080 14:69883264-69883286 GAGAGGGAAAGGAGAGAGGTTGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119095165 14:71823352-71823374 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1119180213 14:72600325-72600347 CAGAGAGGAGGGAGGGAGGGAGG - Intergenic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119883031 14:78116567-78116589 CAGTTGGAAAGTAGGGAGGTTGG + Intergenic
1120027991 14:79607781-79607803 AGGAGGCTAAGGTGGGAGGTTGG - Intronic
1120346266 14:83294206-83294228 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1120451886 14:84678949-84678971 CAGAGAGCAAGGATGGAGGGAGG - Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1120700196 14:87690972-87690994 AAGATGGGGAGGAGGGAGGTTGG - Intergenic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121345303 14:93131320-93131342 CAGAAGCTGAGGTGGGAGGTGGG - Intergenic
1121487347 14:94328055-94328077 CAGAGGGAAAGAAGGAAGGACGG - Intergenic
1121624611 14:95374969-95374991 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624642 14:95375072-95375094 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624659 14:95375137-95375159 AAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1121624671 14:95375186-95375208 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624691 14:95375252-95375274 AAGAGGGGAAGGAGAGAGGGAGG - Intergenic
1121624709 14:95375311-95375333 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1121678196 14:95771456-95771478 CAGTGGGGAAGGGGGCAGGTAGG + Intergenic
1121730022 14:96180280-96180302 TGGAGGGTAAGGAGGGAAATTGG - Intergenic
1122029332 14:98901194-98901216 AAGAGGGAAAGGAGGCAGGCAGG - Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122133831 14:99621201-99621223 GAGAGGCTGAGGTGGGAGGTTGG - Intergenic
1122654997 14:103252447-103252469 CAGAGGCTAAGAAGGGTAGTGGG + Intergenic
1122737974 14:103854832-103854854 TGGAGGCTATGGAGGGAGGTAGG + Intergenic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1123683028 15:22776023-22776045 CATGGGGTGGGGAGGGAGGTGGG + Intronic
1123763059 15:23447146-23447168 CATGGGGTGGGGAGGGAGGTGGG + Exonic
1124058541 15:26265231-26265253 CAGCGGGTAAGGGAGGAGGAAGG - Intergenic
1124514251 15:30352753-30352775 AAGGGTGTAAGGAGAGAGGTTGG + Intergenic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1124728668 15:32178011-32178033 AAGGGTGTAAGGAGAGAGGTTGG - Intergenic
1124872731 15:33559084-33559106 CAGAGGGTAAAGGAGGAGGTTGG + Intronic
1124946312 15:34270335-34270357 AGGAGGCTGAGGAGGGAGGTAGG - Intronic
1124954510 15:34351306-34351328 TAGAGGCTAAGGTGGGAGGATGG + Intronic
1125242775 15:37595445-37595467 CAGAGGGTAAGCAAGAAGCTAGG - Intergenic
1125668576 15:41452627-41452649 CAGAGGCTAAAGTGGGAGGATGG + Intronic
1125733181 15:41905772-41905794 GAGAGGGTGAGGTGGGAGGATGG - Intronic
1126242398 15:46460200-46460222 CAGAGTGCTGGGAGGGAGGTGGG + Intergenic
1127165615 15:56243291-56243313 CAGAGGGGTGGGAGGGAGGGAGG + Intergenic
1127229493 15:56973166-56973188 CAGATGGGAGGGAGGGAGGCGGG - Intronic
1127456399 15:59159476-59159498 TGGAGTGTCAGGAGGGAGGTGGG + Intronic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1128322382 15:66702727-66702749 CAGGGAGTAAGAAGGGAGCTGGG + Exonic
1128408589 15:67369527-67369549 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1128502959 15:68241605-68241627 GAGAGACCAAGGAGGGAGGTGGG + Intronic
1128506377 15:68275926-68275948 CAGAGGAGAGGGAGGGTGGTAGG + Intergenic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128617504 15:69121647-69121669 AAGAGGGAAAGGAGGGAGAGAGG - Intergenic
1128655735 15:69460659-69460681 CAGAGGCTAAGGTGGGAAGATGG - Intergenic
1128671335 15:69576632-69576654 GAAAGGGAAAGGATGGAGGTTGG + Intergenic
1128702922 15:69817132-69817154 GAGAGGGGAGGGAGGGAGGGGGG + Intergenic
1128892239 15:71341774-71341796 AAGAGGGTTGTGAGGGAGGTAGG - Intronic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129036709 15:72654751-72654773 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129078983 15:73023115-73023137 CAGAGGGTAAGAAGGCAGGTGGG - Intergenic
1129213178 15:74082474-74082496 CATGGGGTGGGGAGGGAGGTAGG + Exonic
1129397221 15:75258612-75258634 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129400833 15:75282889-75282911 CATGGGGTGGGGAGGGAGGTAGG - Exonic
1129608979 15:77038252-77038274 GAGAGAGAAAGGAGGGAGGGGGG + Intergenic
1129608987 15:77038276-77038298 GAGAGAGAAAGGAGGGAGGGGGG + Intergenic
1129654426 15:77514630-77514652 AAGAGGCTAGGGAGGGAGGCAGG + Intergenic
1129730311 15:77926790-77926812 CATGGGGTCGGGAGGGAGGTAGG + Intergenic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1129959004 15:79666266-79666288 ATGAGGGTGAGGTGGGAGGTTGG + Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130000461 15:80042159-80042181 AAGAGGGAAGGGAGGGAGGGAGG - Intergenic
1130141373 15:81229166-81229188 CAGAGGATAATGAGGGAGACAGG + Intronic
1130226042 15:82058985-82059007 AGGAGGAGAAGGAGGGAGGTAGG - Intergenic
1130231303 15:82099376-82099398 AAGAGGGTGAGGAGGGAGAGAGG - Intergenic
1130234997 15:82125334-82125356 CAGAGGGGAGAGAGGGAGTTGGG + Intergenic
1130239372 15:82171715-82171737 TAGAGAGTGGGGAGGGAGGTTGG + Intronic
1130563848 15:84979013-84979035 CACAGGGGTAGGAGGGAGGCTGG + Intergenic
1130987538 15:88854601-88854623 GAGAAAGGAAGGAGGGAGGTAGG - Intronic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131196940 15:90363241-90363263 AAGGGGTTAAGGAGGGAGCTGGG + Intronic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG + Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131285893 15:91057118-91057140 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1131315889 15:91337096-91337118 GAGAGGGTGAGGAAGGAGGCTGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1132302617 15:100785482-100785504 CAGAAGGTAGGCAGGCAGGTGGG + Intergenic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1133002000 16:2856488-2856510 CAGAGAGTGAGGATGGAGGGAGG - Intronic
1133035635 16:3032599-3032621 TAGAGAGTAAGGAGTGGGGTGGG + Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133462080 16:5995766-5995788 AATAGGGTAGGGAGGGAGCTTGG + Intergenic
1133755753 16:8761300-8761322 GAGGGGGTGAGAAGGGAGGTGGG - Intronic
1133954867 16:10433412-10433434 GGGAGGCTAAGGAGGGAGGGTGG - Intronic
1134028206 16:10970849-10970871 GAGAGGCTGAGGTGGGAGGTTGG - Intronic
1134501898 16:14775872-14775894 CAGAGGCCAAGGAGGGTGGATGG - Intronic
1134534243 16:15012745-15012767 CAGAGGCTTTGGTGGGAGGTTGG + Intronic
1134578663 16:15353022-15353044 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134723925 16:16404523-16404545 CAGAGGCCAAGGAGGGTGGATGG - Intergenic
1134799683 16:17071956-17071978 CAGAAGGCAGGGAGGGAGGGAGG - Intergenic
1134901080 16:17938632-17938654 CACAGATTAAGGAGGGAGGTTGG - Intergenic
1134943505 16:18307347-18307369 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135180487 16:20269428-20269450 CAGAGGGTAGGGAGTTAGGGAGG + Intergenic
1135263331 16:21000019-21000041 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135686305 16:24500893-24500915 GAGAGGCTAAGGTGGGAGGATGG - Intergenic
1136004484 16:27319227-27319249 CAGAGGTCAGGGAGGGAGCTGGG + Intronic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136041862 16:27585754-27585776 CAGAGGCTACGGAGGGTGGCAGG + Intronic
1136174166 16:28506146-28506168 CAGAGGGTAAGGAGGGGGTCTGG - Intronic
1136232401 16:28894394-28894416 CAGAGGGTAAGGAAGGACAGTGG - Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136402440 16:30025881-30025903 CAGAGGGGAAAGAGGAAGGGCGG - Intronic
1136469048 16:30466239-30466261 CAGCGGGTAGGGATGGGGGTGGG - Intergenic
1136519122 16:30785084-30785106 AAGAGGGTCAGGCTGGAGGTGGG + Intronic
1136667433 16:31824546-31824568 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1136989711 16:35144610-35144632 GAGAGGAGAAGGTGGGAGGTGGG - Intergenic
1137002684 16:35243911-35243933 CATGGGGTAAGGTGGGAGGATGG + Intergenic
1137289300 16:47040987-47041009 AAGAGGCTGAGGTGGGAGGTTGG + Intergenic
1137509768 16:49089002-49089024 GAGAGGGTAAGGGGGTAGGAGGG + Intergenic
1137774044 16:51040979-51041001 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1138018730 16:53456909-53456931 CTGACAGTAAGTAGGGAGGTAGG + Intronic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138482576 16:57313317-57313339 CAGAGGGTATGAGGGGAGGCTGG + Intergenic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1138889564 16:61126153-61126175 CAAGGGGTTAGGAGGGAGGGAGG - Intergenic
1138916959 16:61476281-61476303 CAGAGGCCAGGAAGGGAGGTAGG + Intergenic
1139210031 16:65068017-65068039 AAGAGGGAAAGCAGGGAGGGAGG + Intronic
1139292416 16:65870723-65870745 GAGAGGGAAAGGAGGGAGGGAGG + Intergenic
1139398222 16:66658198-66658220 GAAAGGGAAAGAAGGGAGGTAGG + Intronic
1139402972 16:66696732-66696754 CAGCGGAAAGGGAGGGAGGTGGG + Intergenic
1139837819 16:69853777-69853799 TGAAGGGTAAGGAGGGAGGGGGG + Intronic
1139853920 16:69965872-69965894 CAGAGGGGAGGGAGTGAGGGCGG - Intergenic
1139861799 16:70027984-70028006 CAGAGGCTTTGGTGGGAGGTTGG - Intergenic
1139882898 16:70188785-70188807 CAGAGGGGAGGGAGTGAGGGCGG - Intergenic
1139997535 16:70995090-70995112 CAGGGGGCAAGCAGGGAGGGCGG - Intronic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1140267374 16:73432442-73432464 CAGAGGGGAAGGAAGTGGGTTGG - Intergenic
1140337210 16:74118746-74118768 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1140369611 16:74406734-74406756 CAGAGGGGAGGGAGTGAGGGCGG + Intergenic
1140495104 16:75379589-75379611 CAGAGGTTAAGGAGGGGGTGAGG + Intronic
1140541506 16:75760360-75760382 AAGAGAGGAAGGAGGGAGGGAGG - Intronic
1140649050 16:77066596-77066618 CAGAGGGTAGGGGTGGGGGTAGG + Intergenic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1141606861 16:85158812-85158834 CAGAGGGTAAGGAGGTGGGCAGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141734683 16:85844310-85844332 AAGAAGGGAGGGAGGGAGGTAGG - Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141856262 16:86683230-86683252 GAGAGAGGAAGGAGGGAGGGAGG + Intergenic
1142071325 16:88092489-88092511 GAGAGAGGAAGGAGGGAGGGAGG + Intronic
1142223562 16:88866609-88866631 TAGAGGGGCAGGAGGAAGGTGGG + Exonic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142728796 17:1836534-1836556 CCTAGGGTGAGGATGGAGGTGGG - Intronic
1143000188 17:3789461-3789483 GAGAGGGAAGGGAGGGAGGGAGG - Intronic
1143104142 17:4520008-4520030 TCCAGGGTCAGGAGGGAGGTGGG - Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143403821 17:6663205-6663227 GAAAGGGTAAGAAAGGAGGTGGG + Intergenic
1143410236 17:6704218-6704240 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
1143410827 17:6707378-6707400 CAGCTGGGAAGGAGGGAGGCAGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143544360 17:7587895-7587917 CAGAAGGGAAGCAGGGAGGCTGG - Exonic
1143669839 17:8389059-8389081 CAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1143674165 17:8418772-8418794 AAGAAAGAAAGGAGGGAGGTAGG - Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144737139 17:17561503-17561525 CGGACGGTAAGGCTGGAGGTAGG + Intronic
1144835035 17:18152187-18152209 GAGAGGGCCAGGAGGGAGGGAGG + Intronic
1144998084 17:19284534-19284556 GACAGGGTGAGGATGGAGGTGGG + Intronic
1145079071 17:19879673-19879695 AAGGGGGAAAAGAGGGAGGTGGG - Intergenic
1145785110 17:27588495-27588517 CAGATGGTACGGAGGGATATCGG + Exonic
1146121727 17:30201539-30201561 CAGAGGCCAAGGTTGGAGGTGGG - Intronic
1146169465 17:30621603-30621625 CATGGGGTCAGGATGGAGGTGGG + Intergenic
1146170097 17:30625846-30625868 CATGGGGTCAGGATGGAGGTGGG - Intergenic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146343550 17:32041875-32041897 CATGGGGTCAGGACGGAGGTGGG - Intronic
1146675139 17:34768081-34768103 GAGAGGTGAGGGAGGGAGGTGGG + Intergenic
1146725546 17:35152854-35152876 GAGTGGGGAAGGAGGCAGGTGGG - Intronic
1146732914 17:35210909-35210931 CAGAGCGTAAGGATAGCGGTGGG + Intergenic
1146925030 17:36738563-36738585 CAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1146936254 17:36814245-36814267 CAGAGGGTAATGTGGTGGGTGGG - Intergenic
1147383862 17:40070709-40070731 CAGAGGGGAAGGGGAGAGGGAGG + Intronic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148155667 17:45424139-45424161 GAGAGGGCAAGGAGGCAGGGTGG + Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148713319 17:49697744-49697766 AAGAGGCTGAGGTGGGAGGTTGG + Intergenic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148843988 17:50517991-50518013 CAGAGGGAAATGAGGCATGTGGG - Intronic
1148985094 17:51613668-51613690 AATAGGATAAGGAGGGTGGTGGG - Intergenic
1149184956 17:53986509-53986531 AAAAGGGAAAGGAGGGAGGAAGG - Intergenic
1149393736 17:56218208-56218230 AAGAGGGGAGGGAGGGAGGGTGG - Intronic
1149451347 17:56752256-56752278 CAGAGGGCGAGAAGAGAGGTTGG - Intergenic
1149558114 17:57588686-57588708 CAGAGGGCAAGGAGAGAGTGGGG - Intronic
1149587319 17:57800652-57800674 CAGAAGGTAAAGAGGGAGGGAGG - Intergenic
1149884940 17:60330519-60330541 AAGAGAGAAAGGAGGGAGGGGGG - Intronic
1149885301 17:60333659-60333681 GAGAAGGGAAGGAGGGAGGGAGG + Intronic
1150009676 17:61492265-61492287 AAGAGGGGAAGGAAGGAGGGTGG - Intergenic
1150152714 17:62823725-62823747 AAGAGGCTAAGGTGGGAGGATGG - Intergenic
1150645748 17:66976522-66976544 AAGAGAGGAAGGAGGGAGGGAGG - Intronic
1150673152 17:67220057-67220079 CAGCGGTTAAGGTGGAAGGTAGG - Intronic
1150933547 17:69611211-69611233 TAGAGGCTGAGGTGGGAGGTTGG - Intergenic
1151133661 17:71924420-71924442 AAGAGGGAAAGGAGGGAGGGAGG + Intergenic
1151891126 17:76950920-76950942 CAGCTTGTAAGCAGGGAGGTGGG + Intergenic
1152174507 17:78778712-78778734 CAGAGGCCAAGGCGGGAGGATGG + Intronic
1152328513 17:79656850-79656872 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1152434177 17:80264937-80264959 AAGAGGGGAAGGAGGGAGCCAGG - Intronic
1153210743 18:2761261-2761283 AAGAGGGGAAAGAGGGAGGTGGG + Intronic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153253896 18:3151080-3151102 GAGAGGCTAAGGTGGGAGGATGG - Intronic
1153266013 18:3270161-3270183 CAGAAGGGAAGGAGAGAGGGTGG + Intronic
1153644246 18:7180442-7180464 CAGAGGGTTAAGTGGGAGATGGG - Intergenic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1153900704 18:9614739-9614761 CAGCGGGAAAGGCGGGAGGCGGG - Intronic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154274924 18:12950136-12950158 GAGAGGCTAAGGTGGGAGGATGG - Intronic
1154529765 18:15331411-15331433 CAGAGGGGAAGAGGGGAGTTTGG + Intergenic
1155103547 18:22638500-22638522 GAGAGGGGAAGGAGGGAAGGAGG + Intergenic
1156238269 18:35225958-35225980 CAGAGGGTAGGCAGGTAAGTGGG + Intergenic
1156495670 18:37523845-37523867 CAGAGGTGAAGGTGGGAGGAGGG + Intronic
1156718970 18:40046676-40046698 CAGGAGGTAAGGATAGAGGTGGG - Intergenic
1156761803 18:40601049-40601071 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1157204929 18:45689684-45689706 GTGATGGTAAGGAGGGAGGGTGG - Intergenic
1157216581 18:45788431-45788453 AAGAGGCTAAGGTGGGAGGATGG + Intergenic
1157516943 18:48317969-48317991 CAGGGGGTGAGGAAGGAGGCAGG - Intronic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157786858 18:50491435-50491457 ATGAGGGTTAGGAGGGTGGTTGG + Intergenic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158339923 18:56454824-56454846 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1158560098 18:58506215-58506237 AAGAGGGGAGGGAGGGAGGAGGG + Intronic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1158706599 18:59797966-59797988 CAAAGGGTAGACAGGGAGGTGGG - Intergenic
1159244626 18:65789768-65789790 CAGAGGGAAAGGAGGTGGGGAGG + Intronic
1159281074 18:66286835-66286857 GAGAGGCTGAGAAGGGAGGTTGG - Intergenic
1159300053 18:66552056-66552078 GAGAGGGGAAGGAGGGAGTGGGG + Intronic
1159418804 18:68188101-68188123 CAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1160271112 18:77384438-77384460 CAGAGGCTGAGGTGGGAGGGTGG - Intergenic
1160717608 19:583478-583500 GAGAGGGTGAGGGTGGAGGTGGG - Exonic
1161023823 19:2025508-2025530 GAGAGAGGAAGGAGGGAGGGAGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161754142 19:6119361-6119383 GGGAGGGAAAGGAGGGAGGGAGG - Intronic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1161959047 19:7513129-7513151 AAGAGGTTGAGGTGGGAGGTTGG + Intronic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162164937 19:8745942-8745964 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166008 19:8753406-8753428 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167074 19:8760862-8760884 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168140 19:8768329-8768351 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169082 19:8774618-8774640 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169760 19:8779929-8779951 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170826 19:8787388-8787410 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162450273 19:10750104-10750126 CACTGGGGAAGGTGGGAGGTTGG + Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162872716 19:13598567-13598589 AAGAGGGAAAGGAGAGAGGGAGG + Intronic
1162877636 19:13632577-13632599 GAGAGGGAAGGGAGGGAGGGAGG - Intergenic
1163093214 19:15035808-15035830 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1163106243 19:15124666-15124688 CACTGGGGAAGGAGGTAGGTGGG + Intronic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163352008 19:16782980-16783002 GAGAGAGAAAGGAGGGAGGGAGG - Intronic
1163490452 19:17614601-17614623 CAGAGGTGAGGGTGGGAGGTTGG + Intronic
1163556039 19:17993359-17993381 CAGAGGATGAGGTGGGAGTTGGG - Intronic
1163741128 19:19013569-19013591 ACAAGGGGAAGGAGGGAGGTAGG - Intronic
1163871825 19:19828192-19828214 CATAGGGAATTGAGGGAGGTGGG - Intergenic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164028717 19:21380486-21380508 CATAGGGAATTGAGGGAGGTGGG + Intergenic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164588694 19:29494520-29494542 AAGAAGGGAAGGAGGGAGGCAGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164654356 19:29910051-29910073 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164654381 19:29910131-29910153 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164654427 19:29910271-29910293 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165332414 19:35148109-35148131 AAGAGGGGAGGGAGGGAGGGAGG + Intronic
1165498096 19:36166034-36166056 AAGAGGGAAAGGAGGGAGGGAGG - Intergenic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1166050432 19:40255881-40255903 TAGAGGGTGAGGCTGGAGGTTGG + Intronic
1166222018 19:41371397-41371419 GAGAGAGAAAGGAGGGAGGGAGG - Intronic
1166366033 19:42279016-42279038 CAAGGGGTAAAGGGGGAGGTAGG - Intronic
1166623130 19:44322946-44322968 CAGAGACAAAGGAGGGAGGTGGG - Intergenic
1166876845 19:45902629-45902651 AAGAGGGGAGGGAGGGAGGCGGG - Intergenic
1166955793 19:46464068-46464090 CAGAGGGTGAGGTGGCAGCTGGG - Intergenic
1166991538 19:46695723-46695745 AAAAGAGGAAGGAGGGAGGTAGG + Intronic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167044733 19:47042911-47042933 CAGGGGCCAAGGTGGGAGGTGGG - Intronic
1167140093 19:47644443-47644465 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
1167195387 19:48024570-48024592 GAGAGGGAAAGGAGGGGGTTTGG + Intronic
1167507489 19:49878476-49878498 CCTAGGGTAAGGAGGGAGGCGGG - Exonic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1168114105 19:54211382-54211404 TAGGGGGCCAGGAGGGAGGTTGG + Intronic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168277129 19:55284450-55284472 CCGGGGCCAAGGAGGGAGGTGGG + Exonic
924998496 2:385445-385467 CAGGGGGGACGGAGGGTGGTAGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925235573 2:2274353-2274375 GAGAAGGGAAGGAGGGAGGGAGG + Intronic
925294211 2:2767083-2767105 CAGGGGGTAAGCAGGGGTGTGGG - Intergenic
925356741 2:3246963-3246985 GAGAGGGGAAGGAGGGAGGGAGG + Intronic
926025827 2:9543755-9543777 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
926124785 2:10265427-10265449 CAGAGGGGAAGGGGGCAGGGAGG - Intergenic
926227613 2:10979345-10979367 AAGAGGGTGAAGATGGAGGTGGG + Intergenic
926272755 2:11378949-11378971 CACAGGGCAGGGAGTGAGGTGGG - Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926570575 2:14525355-14525377 AAGAGGAGAAGGAGGGAGGGTGG + Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926675841 2:15619168-15619190 CAGAGGGGGAGCAGTGAGGTTGG - Intronic
926884185 2:17582225-17582247 GTGAGGGGAAGGAGGAAGGTGGG + Intronic
927087480 2:19686294-19686316 GGGAGGGGAGGGAGGGAGGTAGG + Intergenic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
928648437 2:33379616-33379638 CAGAGGGGAAGGAAAGAGGAGGG + Intronic
928902561 2:36336002-36336024 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
928919488 2:36511842-36511864 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
929127415 2:38534476-38534498 AAGAGGTAAAGCAGGGAGGTGGG - Intergenic
929230641 2:39556496-39556518 AAGAGGGTGAGGTGGGAGGATGG - Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929442162 2:41972926-41972948 AAGAGGATAGGGAGGGATGTGGG - Intergenic
929481073 2:42308747-42308769 CCTAGAGTAAGGGGGGAGGTGGG - Intronic
929625764 2:43405065-43405087 TAGAGGGGAAGGAGGAGGGTAGG - Intronic
929642064 2:43591439-43591461 TGGAGGGTAAAGAGGGAGGTGGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930982678 2:57546677-57546699 GAGAGAGAAAGGAGGGAGGGAGG + Intergenic
931045323 2:58345157-58345179 GAGAGGCTGAGGTGGGAGGTTGG + Intergenic
931150818 2:59571148-59571170 AAGAAGGCAAGGAGGGAGGGAGG + Intergenic
931161546 2:59697611-59697633 CAGAGGGCTAAGGGGGAGGTGGG - Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
931668651 2:64627543-64627565 GAGAGGGGAGGGAGGGAGGGAGG + Intergenic
932071631 2:68626426-68626448 CAGAAGGGAGGGAGGGAGGGAGG - Intronic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
932692979 2:73929211-73929233 AAGAGGCTAAGGTGGGAGGATGG - Intronic
932702441 2:74001120-74001142 CACAGGGCAGGGAGGGAGGCAGG - Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
933485838 2:82922536-82922558 AGGAAGGTAAGGAGGGAAGTTGG + Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
933889542 2:86754658-86754680 AGGAGGCTAAGGCGGGAGGTTGG - Intronic
934234799 2:90221112-90221134 CAGAGAGTAAGGATGGAGACTGG - Intergenic
934846848 2:97666736-97666758 CAGAGGCTGAGGTGGGAGGTTGG + Intergenic
934883481 2:98004664-98004686 GGGAGGGAAAGGAGGGAGGGAGG - Intergenic
934903551 2:98179931-98179953 AAGAGAGAAAGGAGGGAGGGAGG - Intronic
935194913 2:100807511-100807533 CAGAGGCTCAGGAGGGAGAGAGG + Intergenic
935210874 2:100938582-100938604 CAGAGAGGAGGGAGGGAGGGAGG - Intronic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
935590318 2:104842252-104842274 TGGAGGGATAGGAGGGAGGTAGG - Intergenic
935863058 2:107354871-107354893 AAGAGGGGAAGAAGGGAGGAGGG + Intergenic
936093142 2:109513705-109513727 CACAAGGGAAGGAGGGAGGTGGG + Intergenic
936727643 2:115340847-115340869 CATAGGTAAAGGTGGGAGGTAGG - Intronic
937065118 2:119011792-119011814 GAGAGGGCGAGGAGGGAGTTTGG - Intergenic
937311285 2:120904885-120904907 CAGAGAGAAGGGAGGGAGTTTGG + Intronic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937515566 2:122651203-122651225 AAGAGGGTAAGGTGGCAGGTCGG + Intergenic
937872865 2:126798424-126798446 AAGAGGGTAGGTAGTGAGGTGGG - Intergenic
938104062 2:128518078-128518100 CATAGGGAATTGAGGGAGGTGGG + Intergenic
938138456 2:128777590-128777612 CAGAAGGGACGGAGGGAGGGAGG - Intergenic
938528859 2:132162851-132162873 CAGAGGGGAAGAGGGGAGTTTGG + Intronic
938902763 2:135811972-135811994 AAGAGGCTGAGGTGGGAGGTTGG + Intronic
939101347 2:137897929-137897951 CACAGGATAGGGAGTGAGGTGGG + Intergenic
939501263 2:142987949-142987971 CAGAGGGTGAAGGGGGAGGCAGG - Intronic
939638786 2:144614299-144614321 CAGAAGTTAAGGGGGAAGGTGGG - Intergenic
939949110 2:148447231-148447253 GAAAGGGAAAGGAGGGAGGGAGG + Intronic
940290921 2:152076942-152076964 CAGAGAGTAAGCAGGGAGGGGGG + Intronic
940520393 2:154738266-154738288 CAGAGGCTGGGAAGGGAGGTGGG + Intronic
940527505 2:154835679-154835701 GAGAGAGAAAGGAGGAAGGTTGG - Intronic
940666295 2:156614131-156614153 GAGAGGGAAACGAGGGAGATGGG - Intergenic
941513696 2:166445371-166445393 AAGAGGGGAGGGAGGGAGGGAGG + Intronic
942914617 2:181289819-181289841 GAGAAGGAAAGTAGGGAGGTAGG - Intergenic
942943716 2:181650076-181650098 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
943180749 2:184537527-184537549 AGGAAGGGAAGGAGGGAGGTAGG + Intergenic
943602484 2:189938570-189938592 CAGAGGCTAGGAAGGGTGGTGGG + Intronic
943602550 2:189939114-189939136 CAGAGACAAAGCAGGGAGGTGGG + Intronic
943756377 2:191561233-191561255 CGGAGGGTGAGGTGGGAGGATGG + Intergenic
943949861 2:194119900-194119922 GAGAGGGAAATGAGGGATGTAGG + Intergenic
943992124 2:194709532-194709554 CACAGGGCAAAGAGGCAGGTAGG - Intergenic
944131574 2:196353097-196353119 AAGGGGGTAAGGAGCGAGGCGGG - Intronic
944546600 2:200805115-200805137 CAGATGGGGAAGAGGGAGGTAGG - Intergenic
944809050 2:203310010-203310032 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
945268035 2:207910612-207910634 GGTAGGGAAAGGAGGGAGGTAGG + Intronic
945722009 2:213429103-213429125 AAAAGAGTAAGGAGAGAGGTGGG + Intronic
945753493 2:213817816-213817838 GAGATGGGAAAGAGGGAGGTGGG + Intronic
945783931 2:214210120-214210142 TAGAGGGTAAGGAAGAAGTTGGG + Intronic
945835079 2:214830047-214830069 CTTAGGGTAAAGAGGAAGGTAGG - Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946200784 2:218069663-218069685 CGGAGGTAAATGAGGGAGGTGGG - Intronic
946428625 2:219613245-219613267 CAGTGAGTAAGGGGGGAGATGGG + Intronic
946524646 2:220505246-220505268 AGGAGTGTAAGGAGGGAGGAAGG + Intergenic
946766050 2:223041980-223042002 CAGACGGGAGGGAGGGAGGGAGG - Intergenic
946853195 2:223927925-223927947 AAGGGGGAAAGGAGGGAGGCAGG + Intronic
947220670 2:227788819-227788841 TTGAGGGTGAGGAGGGAGTTGGG + Intergenic
947422526 2:229953707-229953729 AAGAGGGGAAGGAGAGAGGAGGG + Intronic
947455751 2:230252427-230252449 AAGAGGGAAATGAGGGAGGCAGG + Intronic
947833388 2:233158033-233158055 GAGAGGGGAAGGAGGGAGGCAGG + Intronic
947875753 2:233467371-233467393 CAGAGGGGAAGCAGGCAGGGTGG - Intronic
948132207 2:235609008-235609030 AAGAAGCTAAGGAGGGAGGAAGG + Intronic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948766898 2:240227041-240227063 CAGTTGGAAAGGAGTGAGGTAGG + Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168764571 20:373005-373027 CTGAGGATAAAGGGGGAGGTGGG - Intronic
1168955062 20:1828914-1828936 GAGAGGGGAAGGAAGGAGGGAGG - Intergenic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169276505 20:4236729-4236751 CAGACAGGAAGGAGGGAGGCAGG + Intronic
1169276582 20:4237148-4237170 CAGAGGACCAGGAGGGAGATGGG + Intronic
1169442485 20:5644322-5644344 GAGAGGGTAAGGAGGTGGGGTGG - Intergenic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1169509906 20:6252209-6252231 GAGAGGGGAAGGAGGGAGGCAGG + Intergenic
1169723163 20:8700876-8700898 CAGTGGGTGAGGATGGATGTGGG + Intronic
1169902981 20:10571589-10571611 CAGAGGGTGAGCAGGGAGAGAGG - Intronic
1170037695 20:12006010-12006032 CAGAGAGGAAGGAGAGGGGTTGG - Intergenic
1170286010 20:14709416-14709438 CATAAGGTAAGGAGGGTGTTTGG + Intronic
1170334273 20:15250703-15250725 CAAAGGATAAGAAGGGAGGCAGG - Intronic
1170813908 20:19696928-19696950 CAATGGGGAAGGAGGGAGGGAGG + Intronic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171370944 20:24661557-24661579 AAGAGAGGAAGGAGGGAGGGAGG + Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171481390 20:25458238-25458260 CAGATGGTAAGGAAGGCTGTAGG - Intronic
1171756392 20:29113761-29113783 AGGAAGGGAAGGAGGGAGGTAGG + Intergenic
1172171741 20:32939626-32939648 GAGAGAGAAAGGAGGGAGGAAGG - Intronic
1172403504 20:34670432-34670454 GGGAGGCTAAGGTGGGAGGTGGG - Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172479229 20:35261123-35261145 CAGGGGGTAGGGAGTCAGGTAGG - Intronic
1172554731 20:35831148-35831170 GAGAAGGAAAGGAGGGAGGGAGG - Intronic
1172649787 20:36494732-36494754 GGGAGGGCAAGGAGGGAAGTAGG - Intronic
1172938877 20:38641070-38641092 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1172974549 20:38896127-38896149 AAGAAGGAAAGGAGGGAGGAAGG - Intronic
1173009356 20:39167780-39167802 CAGTGGGTTAGGGAGGAGGTAGG - Intergenic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173152508 20:40579649-40579671 GAGAGGGTGAGGCTGGAGGTGGG - Intergenic
1173324171 20:42017494-42017516 CAGAGGGAGAGGAGGCTGGTGGG - Intergenic
1173432371 20:43000052-43000074 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1173844850 20:46181643-46181665 AAGAGAGAAAGGAGGGAGGGAGG - Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1173943778 20:46933825-46933847 CAGAGAGTAATGAGAGAGGCAGG + Intronic
1174232288 20:49055610-49055632 AAGAGGCTGAGGTGGGAGGTTGG + Intronic
1174415855 20:50366508-50366530 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1174682532 20:52422649-52422671 CAGAGGCTGGGAAGGGAGGTAGG - Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174882056 20:54290791-54290813 CACAGGGTGAGGTAGGAGGTTGG + Intergenic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1174959537 20:55139541-55139563 CAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175388509 20:58612146-58612168 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1175930503 20:62491728-62491750 CAGAGAGGAAGGAGAGAGGGAGG - Intergenic
1176425807 21:6547590-6547612 CCAAGGGAAAGCAGGGAGGTGGG - Intergenic
1176767647 21:13037061-13037083 CAGAGGGGAAGAGGGGAGTTTGG - Intergenic
1177159850 21:17535901-17535923 GAGAGGCTAAGGTGGGAGGATGG + Intronic
1177347412 21:19891411-19891433 GAGAGGATTAGCAGGGAGGTAGG - Intergenic
1177454747 21:21322301-21322323 GAGAAGGGAAAGAGGGAGGTGGG + Intronic
1178091292 21:29166161-29166183 CAGAGGTTGGGGAGGGTGGTAGG - Intronic
1178104133 21:29299278-29299300 CCGAGGGCAGGGAGGGGGGTGGG - Intronic
1178260099 21:31091538-31091560 CAGAGGGTGAGAAGGGTAGTGGG - Intergenic
1178320602 21:31602286-31602308 GAGAGGGAAAGGAGGCAGGGCGG + Intergenic
1178348283 21:31850969-31850991 TAGGGGGCAAGGAGAGAGGTGGG - Intergenic
1178365915 21:31988758-31988780 GAGAGAGAAAGGAGGGAGGGAGG - Intronic
1178372454 21:32037653-32037675 CAGAGTGTTGGGAGGTAGGTTGG + Intronic
1178381637 21:32114701-32114723 CAGAGAGCAAGGAGGAAGGTGGG + Intergenic
1178688281 21:34728734-34728756 CAGAGGGTGGGGAGAGAGGGTGG + Intergenic
1178915800 21:36705060-36705082 CAGGGCGTAAGGAGGGAGTTTGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179556675 21:42182987-42183009 TGGAGGGTCAGGAGTGAGGTGGG - Intergenic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179701298 21:43155907-43155929 CCAAGGGAAAGCAGGGAGGTGGG - Intergenic
1179749049 21:43458110-43458132 CAGAGGCTGAGAAGGGAAGTCGG - Intergenic
1179788571 21:43743099-43743121 CAGAGCGGGGGGAGGGAGGTGGG - Intronic
1180041240 21:45281395-45281417 CAGAGGTTGTGGAGGGAGCTAGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180133833 21:45847385-45847407 GTGAGGGTAAGGATGGAGGTGGG - Intronic
1180169178 21:46049076-46049098 TAGAGGGCATGGAGGGCGGTGGG - Intergenic
1180186805 21:46144416-46144438 AAGAGGGGAGGGAGGGAGGGGGG - Intronic
1180387490 22:12192115-12192137 CAGAGGGTGAGGTAGGAGGATGG - Intergenic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181062453 22:20288168-20288190 CAGAGGGGCAGGAGCGAGGAGGG - Intergenic
1181186173 22:21105988-21106010 GAGAGGGGAAGGAGGGGGATAGG - Intergenic
1181375568 22:22455164-22455186 CAGAGGGAACGGAGGGAGCCAGG + Intergenic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181824376 22:25502598-25502620 CAGAGGCTCAGGTGGGAGGATGG - Intergenic
1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG + Intronic
1182150490 22:28024031-28024053 CAGAAGGGAGGGAGGGAGGGAGG - Intronic
1182198343 22:28542353-28542375 CAGAAGGTGAGGAAGGAGGGAGG + Intronic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183003513 22:34880914-34880936 CAGAGGGTAATGAGACTGGTGGG + Intergenic
1183055084 22:35300198-35300220 CAGTAGGTAAGGAGAGAGGGTGG + Intronic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183618323 22:38958394-38958416 CAGAAGGGAAGGAAGGAGGGAGG - Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1184280798 22:43436379-43436401 CAGAGGGCCAGGAGTGAGGCAGG + Intronic
1184362623 22:44027305-44027327 CAGTGGGCCAGGATGGAGGTCGG + Intronic
1184402196 22:44280677-44280699 CATGGGGGAGGGAGGGAGGTGGG + Intronic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184802278 22:46768752-46768774 CAGAGGGTATGCAGGCAGCTGGG + Intronic
1184920309 22:47600997-47601019 CAGAGGCTGAGGGGGGCGGTGGG - Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185341199 22:50291883-50291905 CAGAGGGTTACGAGGGATGGAGG + Intronic
949339879 3:3017961-3017983 AGGAAGGTAAGGAGGGAAGTAGG - Intronic
949342539 3:3045177-3045199 CAGAGGGCAAGGAGGCAGGCAGG - Intronic
949344892 3:3067662-3067684 CACAGGGCAAGAAGGGAGGAAGG + Intronic
949812071 3:8016598-8016620 AACAGGGCAGGGAGGGAGGTGGG + Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950007632 3:9701705-9701727 CAGGTGGTATGGAGGGAGGGAGG + Intronic
950308087 3:11931725-11931747 AAGAGGCTAAGGTGGGAGGATGG + Intergenic
950448317 3:13051187-13051209 CAGAGGTGAAGGATGGAGGAGGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
952046395 3:29326577-29326599 CAGAAGGTAGTGAGGAAGGTAGG - Intronic
952047712 3:29344120-29344142 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
952538371 3:34338295-34338317 CAGAGGCTGAGGAGGTAGGGTGG + Intergenic
952944194 3:38466199-38466221 CAGAGGCTAAGGAGGTAGGTAGG + Intronic
953098866 3:39806704-39806726 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
953117183 3:40004626-40004648 CAGAAGGAAAGGTGGGAGTTGGG - Intronic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
953796663 3:45991456-45991478 CAGAGGGGAAGAAGGGAAGGAGG - Intronic
954035774 3:47850254-47850276 CAAAGAGGAAGGAGGAAGGTAGG + Intergenic
954220937 3:49153544-49153566 CAGAGGTTAAGGATGGAATTAGG + Intergenic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954479853 3:50788751-50788773 CTGAGGGCAAGGAGGGTGGCAGG + Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954554688 3:51508637-51508659 CAGAGGGCCAGGTGAGAGGTGGG - Intergenic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954593066 3:51800813-51800835 GAGAGGTGAAGGAGGGAGGGAGG + Intergenic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954763829 3:52897015-52897037 GAGATGGTAAGGTGGGAGGTAGG + Intronic
955002191 3:54937835-54937857 CAGAGGGTGAGGAAGGAGCTTGG + Intronic
955072439 3:55583442-55583464 GAGAGGGGAAGGAGGGAGGGAGG - Intronic
955200892 3:56851242-56851264 CACAGTGCTAGGAGGGAGGTGGG - Intronic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
955852491 3:63235648-63235670 CATGGGGGAAGGAGAGAGGTAGG - Intronic
955933027 3:64077023-64077045 AAGTGGGAAAGGAGGAAGGTGGG + Intergenic
956018329 3:64907934-64907956 CAGAGGGAAAGCAGGAAGATGGG + Intergenic
956219312 3:66884752-66884774 CAGAAGGGAGGGAGGGAGGGAGG + Intergenic
956321948 3:68007601-68007623 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957938706 3:86977257-86977279 GAGAGGGTAAGAAGGGAGGGAGG + Intronic
958070162 3:88599660-88599682 GAGAGGGGAGGGAGGGAGGGAGG - Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
959633317 3:108533617-108533639 CAGACTGTGAGGAGGGAGTTGGG + Intergenic
959658195 3:108834342-108834364 CAGAGAGAAAGGGTGGAGGTGGG - Intronic
960784600 3:121358261-121358283 CAGAGGGTGAGAAGGGTAGTGGG - Intronic
960875170 3:122288554-122288576 TAGAGGGGAAGGAGTGAGCTAGG - Intergenic
960884113 3:122376814-122376836 GCAAGGGTAAGGAGGAAGGTGGG + Intronic
960891451 3:122452613-122452635 GGGAGGGAAAGGAGGGAGGGAGG + Intronic
961491766 3:127261347-127261369 CACAGGGGAAGGAGGCAGGATGG - Intergenic
961517727 3:127448688-127448710 CAGAGAGTAAGGAGGGAGCGTGG - Intergenic
961519144 3:127456743-127456765 CAGAGAGGAAGTGGGGAGGTGGG + Intergenic
961966005 3:130903618-130903640 CAGAAGGAAAGAAGGGAGGGAGG - Intronic
962139106 3:132769609-132769631 GAAAGGATAAGAAGGGAGGTGGG - Intergenic
962234923 3:133699629-133699651 CAGAGGGGAAGATGGCAGGTGGG - Intergenic
962411496 3:135144867-135144889 CCCAGGGTAAGGAGGAAGATAGG + Intronic
962446473 3:135470348-135470370 GAGAGGGTAAGGATTGAGTTGGG + Intergenic
962490866 3:135892970-135892992 AAGAGGGAAGGGAGGGAGGGAGG + Intergenic
962557135 3:136565039-136565061 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
962716506 3:138130775-138130797 CTGAGGGTAAGGACTCAGGTCGG - Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963880776 3:150525802-150525824 GAGAGGCTAAGGTGGGAGGATGG + Intergenic
964484571 3:157174647-157174669 CAGAGGTCAAGCAGGGAGGTGGG + Intergenic
964531363 3:157671439-157671461 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
964938225 3:162121589-162121611 CAGAGGCCAGGAAGGGAGGTGGG - Intergenic
965520834 3:169666826-169666848 GAGAGGGAAAGGCGAGAGGTGGG - Intergenic
965588991 3:170344604-170344626 AAGAGGGGAAGGAGAGAGGGAGG - Intergenic
965619357 3:170627021-170627043 AAGAGGGAACTGAGGGAGGTGGG - Intronic
966256456 3:177922051-177922073 CAGAGGCTAGGGTGGCAGGTAGG - Intergenic
966419764 3:179726088-179726110 CAGATGGTAGGGAGTGAGGAAGG + Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966905459 3:184521165-184521187 CAGAGGCTGAGGTGGGAGGGTGG - Intronic
966944132 3:184765774-184765796 CAGCGAGGGAGGAGGGAGGTAGG + Intergenic
967277376 3:187789909-187789931 AAGAGGGGAAGGAGGGAGGGAGG + Intergenic
967337537 3:188361435-188361457 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
967449096 3:189602441-189602463 CAGAGGCTAAGAAAGGAGGGAGG + Intergenic
967523973 3:190470903-190470925 CAGAGACAAAGCAGGGAGGTGGG + Intergenic
968005197 3:195237962-195237984 CAGTGGGGAAGGTAGGAGGTAGG - Intronic
968006636 3:195247571-195247593 CAGAGAGCCAGGAAGGAGGTGGG - Intronic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968272650 3:197416449-197416471 GACAGGGTAAGGGGAGAGGTGGG - Intergenic
968339211 3:197941147-197941169 GAGAGAGGAAGGAGGGAGGGAGG - Intronic
968902789 4:3439177-3439199 CAGTGGGGAAGCAGGGTGGTAGG + Intronic
968947761 4:3674652-3674674 CACAGGGTCAGGACGGGGGTCGG - Intergenic
969038064 4:4272058-4272080 CAGAGGCTAAGGAGGGGGTGGGG + Intronic
969143558 4:5100760-5100782 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
969481437 4:7448931-7448953 GAGAGGGAAAAGAGGGAGGGAGG - Intronic
969811670 4:9653006-9653028 AACTGGGTTAGGAGGGAGGTTGG - Intergenic
969870843 4:10103786-10103808 GAGAGTGGGAGGAGGGAGGTGGG - Intronic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
969939848 4:10721149-10721171 CAGGGACTGAGGAGGGAGGTGGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970488198 4:16545217-16545239 CAGAAGGAAGGGAGGGAGGGGGG - Intronic
970490876 4:16572347-16572369 CAGACGGTAAGGTGGGAAATTGG - Intronic
971503183 4:27338519-27338541 CATAGGGCAGGGAGGGAGGGAGG + Intergenic
972103200 4:35447707-35447729 TAGAGGGTAAGAAGGAAGGAAGG + Intergenic
972276330 4:37561200-37561222 CAGAGAGGAAGGAGGGAATTGGG - Intronic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972680232 4:41299152-41299174 AAGAGGGAAGGGAGGGAGGGAGG - Intergenic
973252672 4:48076731-48076753 AAGAGGCTAAGGTGGGAGGATGG - Intronic
973967118 4:56174443-56174465 CAGAGGCTAAGAAGGGAAGCAGG - Intronic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
974700061 4:65431587-65431609 AAAAAGGAAAGGAGGGAGGTCGG - Intronic
974707544 4:65541042-65541064 GAAAGGGGAAGGAGGGAGGGAGG - Intronic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975228462 4:71902921-71902943 CAGAAAGGAAGGAGGGAGGGAGG - Intergenic
975669471 4:76766427-76766449 CAGAGGATGAGGTGGGAGGCAGG + Intronic
975670465 4:76775102-76775124 CAGCGGGAAGGGTGGGAGGTGGG - Intronic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976355342 4:84110822-84110844 GAGAAGGGAAGGAGGGAGTTGGG - Intergenic
976779444 4:88742235-88742257 CAAAGAGTAAGGAAGGAGATTGG - Intronic
977197281 4:94079104-94079126 CAGAGGCTAAGGAGGATAGTGGG - Intergenic
977794433 4:101145620-101145642 CAGAGGCTAAGAAGGGTAGTTGG + Intronic
978022902 4:103835172-103835194 CAGAGGGTAAGGAGCATAGTAGG - Intergenic
978051641 4:104207815-104207837 CATAGGGTATGGAGGCAGGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
978243390 4:106542998-106543020 CAGAGGGTAAAGGGGGTGGCAGG + Intergenic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
979138491 4:117141972-117141994 CAGAGGGTAAGGAGGGTGGGTGG + Intergenic
979407156 4:120327531-120327553 GAGAGAGTAAGGGGGAAGGTTGG + Intergenic
979605805 4:122637525-122637547 CAAAGGGTAAGGATAGAGGGAGG + Intergenic
979745362 4:124206043-124206065 CAGAGGGTCAGGAGGTGGGGAGG + Intergenic
980482832 4:133410946-133410968 AAGATGGTGAGGAGGGAGGTTGG - Intergenic
980559763 4:134458216-134458238 GAGAGGGTAAGAAGGAAGGAAGG + Intergenic
980918368 4:139056091-139056113 CAGGTGGTAAGGATGGATGTTGG + Intronic
981184856 4:141789027-141789049 CATGGGGTAAGGGTGGAGGTGGG - Intergenic
981253617 4:142634025-142634047 CAGATAAAAAGGAGGGAGGTGGG + Intronic
981413373 4:144458875-144458897 AAGAAGGGAAGGAGGGAGGAAGG + Intergenic
982087516 4:151851243-151851265 CACAGGCTAAGGGGGGAGATGGG - Intergenic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982816489 4:159891937-159891959 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
982846018 4:160253358-160253380 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
984224956 4:177023529-177023551 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984974191 4:185215899-185215921 GGGAGGGTGAGGTGGGAGGTGGG - Intronic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985552597 5:541188-541210 GAGATGGCAAGGAGGGCGGTGGG - Intergenic
985648886 5:1098346-1098368 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648894 5:1098373-1098395 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648902 5:1098400-1098422 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648920 5:1098455-1098477 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648928 5:1098482-1098504 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648955 5:1098564-1098586 CAGAGGGTTAGAAGGGGGCTTGG - Intronic
985648971 5:1098618-1098640 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985648979 5:1098645-1098667 CAGAGGGTTAGAAGGGGGCTGGG - Intronic
985841969 5:2313313-2313335 CAGAGGCTCAGGAGGAGGGTGGG - Intergenic
985851636 5:2392670-2392692 AAGAGAGGAAGGAGGGAGGAAGG - Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
986210337 5:5665640-5665662 CAGACAGCAAGGAGGGAGGAAGG + Intergenic
986286776 5:6365123-6365145 CAGGGGGTACTGAGGGAGATGGG - Intergenic
986393630 5:7306557-7306579 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986500476 5:8393316-8393338 AAGAAGGGAGGGAGGGAGGTAGG + Intergenic
986535302 5:8780276-8780298 CAGAGGGTTAGGAGTGAAGGGGG + Intergenic
986831818 5:11588876-11588898 CAGGGAGGGAGGAGGGAGGTGGG - Intronic
987057399 5:14207188-14207210 GAGAGGCTGAGGTGGGAGGTTGG + Intronic
987328110 5:16830896-16830918 CAGAGGCTAAGGAGGGAACTGGG + Intronic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988393783 5:30670002-30670024 CAGATGGTAAGGACTGAAGTTGG + Intergenic
988456379 5:31390597-31390619 CAGAGGGGAAGGGGTGGGGTGGG + Intergenic
988481076 5:31631096-31631118 CACGAGGGAAGGAGGGAGGTGGG + Intergenic
988623636 5:32848437-32848459 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
989164170 5:38418379-38418401 CAGAACATCAGGAGGGAGGTGGG + Intronic
989368627 5:40681923-40681945 CAGAGGGAAAGCAGGGAGCGGGG - Intronic
989784074 5:45305824-45305846 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
990136889 5:52656008-52656030 GGGAGGGAAAGGAGGGAGGGAGG + Intergenic
990374458 5:55155463-55155485 CAGAGGTTAAGGAACGGGGTTGG - Intronic
990500838 5:56395628-56395650 GAGAGGGAAAGGTGGGAGGAGGG + Intergenic
991024352 5:62014131-62014153 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
991092481 5:62706432-62706454 GAGAGGATTAGGAGAGAGGTGGG + Intergenic
991099421 5:62776165-62776187 CATAGGGAATTGAGGGAGGTGGG + Intergenic
991379776 5:66007858-66007880 CAGCAGCTAAGGAGGGAGGTGGG + Intronic
991380359 5:66016559-66016581 CAGAGGCTGAGGAGGGTAGTGGG - Intronic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992018820 5:72602398-72602420 CAGAGTGGAAGCTGGGAGGTTGG - Intergenic
992542492 5:77778669-77778691 CACAGGATAAGATGGGAGGTTGG + Intronic
992587793 5:78259361-78259383 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
992792786 5:80228282-80228304 GGGAGGGAAAGGAGGGAGGGAGG + Intronic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
993042727 5:82834057-82834079 CAGTGGGGAAGGAGGCAGGGTGG + Intergenic
993054604 5:82967933-82967955 CAAAGACCAAGGAGGGAGGTGGG + Intergenic
993281252 5:85927643-85927665 ATGAAGGTAAGGAGGGAGGGAGG - Intergenic
993608788 5:90029160-90029182 CAGAGGGAAGTGTGGGAGGTGGG + Intergenic
993686678 5:90945988-90946010 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994730982 5:103490474-103490496 AAGGAGGGAAGGAGGGAGGTTGG - Intergenic
994918199 5:106006123-106006145 CAGACACAAAGGAGGGAGGTGGG - Intergenic
994945071 5:106377213-106377235 GAGAGAGGAAGGAGGGAGGGAGG - Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
996445021 5:123537843-123537865 CAGCGGTTAAGTAGGGTGGTAGG - Intronic
996775567 5:127128844-127128866 TAGAAGGTAAGATGGGAGGTGGG + Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
996892523 5:128438765-128438787 CAGAGAGTAAGGTTGGGGGTGGG - Intronic
997002577 5:129779764-129779786 CAGAGGCTGAGAAGGGAAGTGGG + Intergenic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997501916 5:134382007-134382029 CAGAGGCTAAGGCAGGAGGGTGG + Intronic
997649830 5:135508152-135508174 AAGAGGGGAAGGAGGGCGGGAGG + Intergenic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998168207 5:139856424-139856446 CAGAGGGTAAAGAGGACAGTCGG - Intronic
998351249 5:141503103-141503125 CAGAGGGTATGAAGAGAGGCAGG - Intronic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
999232394 5:150069488-150069510 CAGAGGCTGATGAGGGAGGCAGG - Intronic
999397603 5:151239935-151239957 AAGAGGGTAGGAGGGGAGGTAGG + Intronic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000120488 5:158193364-158193386 AAGTGGGGAAGGAGGGAGCTGGG - Intergenic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1000982624 5:167832697-167832719 GAGAGGGAAAGGAGGGATGGAGG + Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001130793 5:169061866-169061888 CAGAGGGTAGGGAGTGGGGTGGG - Intronic
1001335151 5:170790631-170790653 GAGAGGGAAGGAAGGGAGGTTGG + Intronic
1001499791 5:172221684-172221706 CATGGGGTTAGGAGGGAGGCAGG + Intronic
1002025272 5:176392592-176392614 CAGAGGGCCAGGAGGGAGCGAGG + Exonic
1002208296 5:177579440-177579462 CAGAGTCTAAGGTGGGAGGATGG + Intergenic
1002281995 5:178136420-178136442 CAGAGGGGATGGTGGGGGGTGGG + Intronic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002850340 6:989559-989581 CAGAAGGCAAGGAGGGAGCAAGG + Intergenic
1003079611 6:3010652-3010674 CAGAGACAAAGGAGGGAGATGGG + Intronic
1003521503 6:6862390-6862412 GAGAGGGAAGGGAGGAAGGTTGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003775330 6:9354306-9354328 CAGAGACAAAGGAGGGAGGCAGG + Intergenic
1004180395 6:13376180-13376202 CAGAGTCTAAGGAGGCAGGGAGG + Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004723295 6:18287998-18288020 CATAGAGAAAGGAGAGAGGTGGG + Intergenic
1004987009 6:21093831-21093853 AGGAGGCTAAGGTGGGAGGTGGG - Intronic
1005008294 6:21311961-21311983 CAGAAGGGGAGTAGGGAGGTGGG - Intergenic
1005159596 6:22843595-22843617 CAGAGGGCAAAGAGGAAGGAGGG - Intergenic
1005205093 6:23393729-23393751 AAGAGGGAAGGGAGGGAGGGAGG + Intergenic
1005429719 6:25742418-25742440 GAGAGGTCAAGGAGGGAGGATGG + Intergenic
1005838597 6:29725301-29725323 GATGGGGTAAGGAGGGAGATGGG + Exonic
1005859506 6:29889599-29889621 GATGGGGTAAGGAGGGAGATGGG + Intergenic
1005867070 6:29944392-29944414 GATGGGGTAAGGAGGGAGATGGG + Exonic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006488630 6:34366466-34366488 GAGAGGGAAGGGAGGGAGGGAGG + Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006528029 6:34625171-34625193 AAGAGGGGAAGGGGGGAGGAGGG - Intronic
1006706512 6:36025572-36025594 CAAAGGGTGAGGAGGAAGCTTGG - Intergenic
1006888205 6:37400052-37400074 GAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1007040793 6:38720265-38720287 CAGAGATGAAGGAGGGAGATAGG + Intronic
1007407547 6:41643663-41643685 GAGAGAGAAAGGAGGGAGGAAGG + Intronic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007616110 6:43180606-43180628 CAAAGGGGGAGGAGGGGGGTGGG - Exonic
1007753304 6:44083046-44083068 CAGAGGGGAATGAAGGGGGTGGG - Intergenic
1007753522 6:44084117-44084139 CAGAGAGTGAGGATAGAGGTAGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008250739 6:49236849-49236871 CAGGGGGAAAGGTGGGAGCTGGG - Intergenic
1008628638 6:53343194-53343216 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
1009834050 6:68974526-68974548 AAGAGACTAAGGAGGGAGGATGG + Intronic
1010324401 6:74548480-74548502 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1010438619 6:75865466-75865488 GAGAGGCTAAGGTGGGAGGATGG - Intronic
1010611295 6:77956780-77956802 CAGAGGCTAGGGAGGGTAGTGGG + Intergenic
1011001015 6:82588711-82588733 CAGAGGCTAAGGTGGGAGGATGG + Intergenic
1011153645 6:84303929-84303951 CAGAGGCTAGGGTGGGAAGTTGG + Intergenic
1011362620 6:86544066-86544088 GAGAGGGGAGGGAGGGAGGGAGG + Intergenic
1011486963 6:87852836-87852858 TAAAGGGGAAGAAGGGAGGTGGG - Intergenic
1011534440 6:88360813-88360835 AGGAGGGAAAGGAGGCAGGTGGG - Intergenic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1011946702 6:92913729-92913751 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1012505411 6:99940972-99940994 CAGAGACAAAGTAGGGAGGTGGG - Intronic
1013201158 6:107897018-107897040 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1013216618 6:108033133-108033155 AAGAGGGAAAGAAGGGAGGGAGG - Intergenic
1013217367 6:108040010-108040032 CATGGGGTGGGGAGGGAGGTGGG + Intergenic
1013456253 6:110332075-110332097 CAGAGGGTAGGCTGGGAGGCAGG + Intronic
1013545548 6:111153428-111153450 AGGAGGCTAAGGTGGGAGGTTGG + Intronic
1013761597 6:113524824-113524846 CAGAGGGTAATGAGAGAAGAAGG + Intergenic
1014054477 6:116997825-116997847 TGGAGGGGAAAGAGGGAGGTAGG - Intergenic
1014856819 6:126412059-126412081 GAGAGAGAAAGGAGGGAGGGAGG - Intergenic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015153307 6:130062961-130062983 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
1015185902 6:130415195-130415217 CAGAGGGCAAGCAGGGAGTTAGG + Intronic
1015235141 6:130962277-130962299 CAGAGGGGAAGGAGGAAGTGGGG + Intronic
1015567453 6:134588074-134588096 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
1015678093 6:135772908-135772930 CAGAGGCTGAGAAGGGTGGTGGG - Intergenic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1016045843 6:139479635-139479657 CAGAGTGTCAGGATGGAGGAGGG + Intergenic
1016091580 6:139985683-139985705 GAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1016384968 6:143521909-143521931 CAGAGGGTCTGGATGCAGGTGGG + Intergenic
1016406376 6:143735594-143735616 CAGAGGGTAAGTGGTGGGGTGGG - Intronic
1016421742 6:143892256-143892278 AAGAGGGAAGGGAAGGAGGTGGG + Intronic
1016547362 6:145239128-145239150 CAGAAAAGAAGGAGGGAGGTAGG - Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1016714168 6:147204396-147204418 GTGAGGGTAAGGAGGCAGCTGGG - Intergenic
1016722862 6:147323052-147323074 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1016827424 6:148401147-148401169 CGGAGGTTAAGGTGGGAGGATGG + Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017715278 6:157206676-157206698 CGGAGCTTAAGGGGGGAGGTGGG - Exonic
1017804197 6:157929205-157929227 CAAAGGAGAAGGAGGGAGGCAGG - Intronic
1017915047 6:158825223-158825245 GAGAGGCTGAGGTGGGAGGTTGG - Intergenic
1018328418 6:162700098-162700120 CATAGGGAAAGGAGAGAGGAGGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1019078848 6:169413596-169413618 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019149712 6:169997149-169997171 GAGAGGGAAAGCAGGAAGGTGGG + Intergenic
1019313480 7:374051-374073 CAGAGGGAAAGAAGGAAGGGAGG + Intergenic
1019313493 7:374117-374139 CAGAGGGAAGGAAGGGAGGGAGG + Intergenic
1019495469 7:1337718-1337740 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1019806465 7:3129933-3129955 GTGAGGGGAAGGAGGGAGGGAGG + Intergenic
1020065742 7:5187279-5187301 CAGAGGCTAAGGCGGGAGGATGG - Intergenic
1020088708 7:5325179-5325201 CAGAGGGCAAGGCAGGAGCTCGG + Exonic
1020164342 7:5796414-5796436 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1020531229 7:9338482-9338504 GAGAGGGAAAAGAAGGAGGTTGG + Intergenic
1020549442 7:9583685-9583707 CACAGGATAAGGAAGGAAGTAGG - Intergenic
1020677505 7:11198681-11198703 AAGAGGGGAAGGAGGGAAGGAGG - Intergenic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021818129 7:24468091-24468113 CAGAAGTTAAGGATGGAGGAAGG - Intergenic
1021902137 7:25296653-25296675 CAGAGAGTAAGGAAAGAAGTTGG - Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022205473 7:28159461-28159483 CAGAGAGGAAGGCGGGAGGTGGG + Intronic
1022268493 7:28782965-28782987 CACAGGGAAAGAAGGGAGGGAGG + Intronic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022647293 7:32243122-32243144 GAGAGAGTAAGGAGGGAGAGTGG + Intronic
1022828478 7:34040829-34040851 GAGAAGGAAAGAAGGGAGGTGGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023195029 7:37627247-37627269 CAGTGGTTAAGGAGGGAGTGAGG - Intergenic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024027417 7:45424466-45424488 CACATGGTGAGGAGGGAGGGAGG + Intergenic
1024283437 7:47737661-47737683 AAGAGGGAAAGGATGGAGGTGGG - Intronic
1024987345 7:55206767-55206789 CAAAGCGTAAGGAGGGGGTTTGG - Exonic
1025065675 7:55853519-55853541 CAGAGGCTAAGAAGGGTAGTGGG + Intronic
1025092960 7:56078302-56078324 CAGAGGGTAGGCGGGGTGGTCGG + Intronic
1025205603 7:56991935-56991957 CAGAGGGCAAGGCGGGAGCTTGG - Intergenic
1025666337 7:63585003-63585025 CAGAGGGCAAGGCGGGAGCTTGG + Intergenic
1026104426 7:67409836-67409858 GAGAGAGAAAGGAGGGAGGGAGG - Intergenic
1026179785 7:68028789-68028811 CGGAGGGAAGGGAGGGAGGGAGG - Intergenic
1026509161 7:71013682-71013704 CAGACAGAAAGGAGGGAGGAAGG + Intergenic
1026655282 7:72251191-72251213 CAGAGTGGAAGGTGAGAGGTGGG - Intronic
1026804304 7:73420190-73420212 CAGAGAGGAAGAAGGGAGGGAGG + Intergenic
1026829640 7:73603002-73603024 CAGAGGCTAGGGAGGGACTTGGG - Intronic
1026874771 7:73872894-73872916 GAGAGAGAAAGGAGGGAGGAAGG - Intergenic
1026923473 7:74173311-74173333 CAGAGGCTAAGGCGGCAGGATGG + Intergenic
1027294163 7:76749906-76749928 CAGAGGAGAGGGAGGGAGATGGG - Intergenic
1028175912 7:87657893-87657915 CACAGGGGAAGGTGGGAGGGGGG - Intronic
1028243782 7:88451926-88451948 ATGAGGGGAGGGAGGGAGGTGGG - Intergenic
1028384570 7:90240166-90240188 GTGAGGCTAAGGTGGGAGGTGGG + Intergenic
1028420424 7:90626698-90626720 CAGAGGCTAAGGTGGGAGGATGG + Intronic
1028480125 7:91295121-91295143 GAGAGGGTGGGGAGGGAGGTGGG + Intergenic
1028520849 7:91729045-91729067 CAGAGGGAAGGAAGGGAGGAAGG + Intronic
1028696386 7:93717753-93717775 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029137825 7:98387148-98387170 CAGAGGGTAGGGAAGGAGCAAGG + Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029465024 7:100720212-100720234 TAGACGGTGAGGAGTGAGGTGGG + Intergenic
1029708979 7:102289335-102289357 CAGGGGGCAAGGGTGGAGGTGGG + Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029882866 7:103835280-103835302 CAGGAGTTAAAGAGGGAGGTAGG + Intronic
1030114587 7:106053670-106053692 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1032034039 7:128508515-128508537 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1032226105 7:130032843-130032865 AGGAGGGGAAGGAGGGAGGGAGG + Intronic
1032402450 7:131633279-131633301 CAGGTGGGAAGAAGGGAGGTTGG - Intergenic
1032449556 7:132018121-132018143 CAGAAGTAAAGGAGGGAGGGAGG - Intergenic
1032490163 7:132318460-132318482 GAGAGGGAAAGCAGGGAGGGAGG - Intronic
1032654016 7:133907857-133907879 AGGAGGGGAAGGAGGGAGGGAGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1033796129 7:144847616-144847638 AAAAGGGGAAGAAGGGAGGTGGG - Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034339356 7:150341789-150341811 TCGAGGGGAAGGAGGGGGGTGGG - Intergenic
1034347235 7:150394656-150394678 AAGAGGGGAGGGAGGGAGGGAGG - Intronic
1034438994 7:151077083-151077105 CAGAGGTAAAGGAGGCAGGGTGG - Exonic
1034551527 7:151823636-151823658 CAGAGGCTAGGGAGAGACGTGGG + Intronic
1034975485 7:155446872-155446894 AAAAGGGGAAGGAGGGAGGGAGG + Intergenic
1035278450 7:157762779-157762801 CAGAGCCAAAGGAGAGAGGTGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413977 7:158667921-158667943 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414046 7:158668123-158668145 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035911177 8:3567727-3567749 CAGAGGATGTGGAGGAAGGTTGG - Intronic
1036157712 8:6358044-6358066 CAGAGGCTAAGGCGGGAGAATGG - Intergenic
1036198987 8:6750314-6750336 CAGAGGATAAGCAGGGCAGTGGG - Intronic
1036612187 8:10359974-10359996 CAGAGATAAAGGAAGGAGGTTGG - Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1036981142 8:13471508-13471530 GGGAGGGAAAGGAGGGAGGGAGG + Intronic
1037365163 8:18114587-18114609 GCGAGGGGCAGGAGGGAGGTAGG - Intergenic
1037474439 8:19242596-19242618 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1037691720 8:21186433-21186455 CAGAGGGAGATGAGGGAGCTGGG - Intergenic
1037742848 8:21621192-21621214 TAGAGGAAAAGGAGGGAGCTAGG + Intergenic
1037752841 8:21693781-21693803 GAGAGGGGAAGGAGAGAGGAAGG + Intronic
1037801999 8:22040957-22040979 CAGGGGGAAAGCAGAGAGGTGGG + Intergenic
1037810088 8:22081753-22081775 CAGAGGGTGAGGAGGAATGAGGG + Exonic
1037825838 8:22160101-22160123 AAGGGGGTGAGGAGGGTGGTGGG + Intronic
1037946319 8:22991714-22991736 CAGAGGGTAAGGGGGATGGCTGG + Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1038064068 8:23943665-23943687 AAGAGGGGAAGGTGGGAGGAAGG - Intergenic
1038129220 8:24710670-24710692 AACAGAGTAAGGAGGGAGGGAGG + Intergenic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038340358 8:26680695-26680717 AAGAGGGGAGGGAGGGAGGGAGG - Intergenic
1038452459 8:27648818-27648840 AAGAGAGAAAGGAGGGAGGGAGG + Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038584661 8:28778048-28778070 CAGGGGGTCAGGAGGGAGCCAGG + Intronic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1039007812 8:33060262-33060284 TAGAGGGGAAGCATGGAGGTAGG + Intergenic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1039968944 8:42305527-42305549 CAGAGGCTAGGGGTGGAGGTAGG - Intronic
1040099733 8:43488184-43488206 AAGAGGAGAAAGAGGGAGGTTGG + Intergenic
1040362144 8:46676068-46676090 CAGAGGCTGAGAAGGGTGGTGGG + Intergenic
1040947506 8:52898981-52899003 CAGAAGTTAAGGAGGCAGTTTGG - Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041802317 8:61813488-61813510 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1042036583 8:64540439-64540461 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1042125768 8:65535828-65535850 CACAGGATAAGGTAGGAGGTCGG + Intergenic
1042455890 8:69002145-69002167 CACAGGGTAAGACAGGAGGTTGG + Intergenic
1042595588 8:70444328-70444350 CAGAGGTTAGGGAGTGGGGTAGG + Intergenic
1043007541 8:74838555-74838577 GAGAGGGGTGGGAGGGAGGTGGG - Intronic
1043086158 8:75835988-75836010 CAGAGGGTAAAGAGAGAGCATGG + Intergenic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043888500 8:85630389-85630411 CAGAGGCTCAGGTGGGAGGACGG + Intergenic
1043927120 8:86049860-86049882 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1044144617 8:88696389-88696411 CAGAAACAAAGGAGGGAGGTAGG - Intergenic
1044177255 8:89142716-89142738 CAGAGGGCATGGGGAGAGGTAGG - Intergenic
1044551071 8:93512989-93513011 CAGAGGGTGGGAAGGGAGGAGGG + Intergenic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1045000140 8:97871289-97871311 GAGAGGGCAAGGAGTGAGGTGGG + Intronic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045498999 8:102730790-102730812 AAGAGGCTAAGGTGGGAGGATGG - Intergenic
1045755112 8:105533698-105533720 GAGAAAGTAAGGAGGGAGGGAGG - Intronic
1045755257 8:105534146-105534168 AAGAGAGAAAGGAGGGAGGAAGG - Intronic
1047047466 8:121070900-121070922 GAGAGGCTAAGGTGGGAGGATGG - Intergenic
1047081417 8:121465535-121465557 GAGAAGGAAGGGAGGGAGGTGGG + Intergenic
1047096974 8:121636386-121636408 CAGAAGGGGAGAAGGGAGGTTGG - Intronic
1047130124 8:122009413-122009435 AGGAAGGTAAGGAGGGAGGGAGG - Intergenic
1047306960 8:123660197-123660219 GAGATTGCAAGGAGGGAGGTTGG - Intergenic
1047458727 8:125041245-125041267 CAAAGGGGAGTGAGGGAGGTGGG + Intronic
1047501651 8:125446380-125446402 AAGAAGGGAAGAAGGGAGGTAGG - Intergenic
1048060359 8:130913320-130913342 TGGGGGGTTAGGAGGGAGGTGGG - Intronic
1048080127 8:131117856-131117878 CAGAGACAAAGAAGGGAGGTAGG - Intergenic
1048205792 8:132414283-132414305 CAGAGAGTCAGGAGGGAGCAGGG + Intronic
1048271361 8:133030744-133030766 CATAAGGGAAGGAGGGAGTTTGG + Intronic
1048348536 8:133596968-133596990 CAGAGGGTAAACGGGGTGGTGGG - Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048971664 8:139648509-139648531 CAGAGGGACAGGAGGCAGGCTGG - Intronic
1049139950 8:140945003-140945025 GAGAGGGCAAGCAGGGAAGTTGG - Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049397039 8:142405695-142405717 CAGAGGGTAGAGAGGAAGGGTGG - Intergenic
1049442568 8:142616061-142616083 CAGAGGGTTGGCAGGGAGGGGGG - Intergenic
1049672804 8:143877312-143877334 CAGAGGGTCCGGAGCGAGGGGGG + Intronic
1049701042 8:144012745-144012767 AAGAGAGTGAGGAGGGAAGTGGG + Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049710931 8:144063002-144063024 CAGTGGGGTAGGAGGCAGGTGGG - Intronic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1050405995 9:5309260-5309282 CAGAGAGTGAGAAGGGATGTGGG - Intergenic
1050572516 9:6956090-6956112 CAGAGGCTGAGGAGGGTAGTTGG + Intronic
1050578119 9:7020958-7020980 CAGAGGCTAGGAAGGGTGGTGGG - Intronic
1051543462 9:18247764-18247786 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1052730575 9:32280504-32280526 GAGAAGGTAGGGAGGGAGGTGGG - Intergenic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1053103964 9:35394700-35394722 CAGGAGGAAAGGAGGGAGTTAGG + Intronic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053474979 9:38376226-38376248 GAGAGAGAAAGGAGGGGGGTGGG - Intergenic
1053707474 9:40769180-40769202 CAGAGGGGAAGAGGGGAGTTTGG + Intergenic
1054417386 9:64889948-64889970 CAGAGGGGAAGAGGGGAGTTTGG + Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1055477599 9:76678384-76678406 GAAAGGGAAAGGAGGGAGGAAGG + Intronic
1055730307 9:79273926-79273948 AAGGAGGTAAGGAGGGAGGGAGG + Intergenic
1056803211 9:89708434-89708456 TGGAGGGTAAAGAAGGAGGTGGG - Intergenic
1056964137 9:91152110-91152132 CAGAGGGGAGGAAGGGAGGGAGG - Intergenic
1056970101 9:91194575-91194597 GAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1057055115 9:91954510-91954532 GAGAGGGCAAGGAGGGGGTTGGG - Intergenic
1057082952 9:92186675-92186697 CAGAGGGGAAGAAGGAAGGATGG - Intergenic
1057243043 9:93429356-93429378 GAGAGGCTAAGGTGGGAGGATGG + Intergenic
1057424007 9:94934251-94934273 GAGAGGGAAGGGAGGGAGGGTGG - Intronic
1057791583 9:98128275-98128297 CAGACAGTGAGGAGGGTGGTAGG + Intronic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059053274 9:110952384-110952406 TAGAGGGTGAGGGGGAAGGTGGG - Intronic
1059086710 9:111310889-111310911 GAGAGGGGGAGGAGGGAGGGAGG - Intergenic
1059340876 9:113597005-113597027 CAGGGGGCAGGGAGGCAGGTGGG - Exonic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1059840168 9:118206137-118206159 GAGAGGGTGGAGAGGGAGGTTGG - Intergenic
1059933208 9:119282188-119282210 CACAGGGAAGGGATGGAGGTGGG - Intronic
1059965482 9:119609668-119609690 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1059965525 9:119609923-119609945 AGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1059988297 9:119840880-119840902 CAGAGAGCAAGGAGGAAGGTGGG + Intergenic
1060106920 9:120878399-120878421 CTGAGGGCAAGGATGGGGGTGGG - Intronic
1060247808 9:121960924-121960946 CAGAGGCTAATGAGAGAGGTGGG - Intronic
1060446144 9:123690043-123690065 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060446156 9:123690075-123690097 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060446177 9:123690131-123690153 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1060815810 9:126634563-126634585 CAGAGGCTAATGCAGGAGGTGGG - Intronic
1060861838 9:126961054-126961076 AGGAGAGTAAGGAGGGAGTTGGG - Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061218992 9:129238019-129238041 CAGAGGCCAGGCAGGGAGGTGGG - Intergenic
1061281959 9:129602666-129602688 CAGACAGGAAGGAGGGAGGGAGG + Intergenic
1061301219 9:129705966-129705988 CAGGGGGTGAGGAGTGAGGTGGG - Intronic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1062044497 9:134418747-134418769 CACAGGGTAAGGTGTGTGGTGGG + Intronic
1062050564 9:134444552-134444574 GAGGGGGAAAGGAGGGAGGGAGG - Intergenic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062332544 9:136051024-136051046 CAGCGGGGAAGGAGGGAGGGAGG + Intronic
1062343785 9:136105441-136105463 CAGAGAGCAGGGAGGGAGCTGGG + Intergenic
1062449155 9:136608299-136608321 GAAGGGGGAAGGAGGGAGGTAGG + Intergenic
1062523678 9:136969859-136969881 CAGGGGGTGAGGATGGGGGTGGG - Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1185712366 X:2314334-2314356 GGGAGGGAAAGGAGGGAGGGAGG + Intronic
1186672348 X:11780550-11780572 CAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1186938007 X:14472519-14472541 AAGAGGTTCAGGAAGGAGGTGGG - Intergenic
1187002807 X:15199870-15199892 CAGCTGGTAGGCAGGGAGGTAGG + Intergenic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187039669 X:15580299-15580321 CAGAGGGGAATGAGGGAAGCAGG - Intronic
1187135164 X:16540972-16540994 GAGAGGGAAAGGAGGAAGGGAGG + Intergenic
1187231788 X:17430233-17430255 AAGAGGGGAGGGAGGGAGGGAGG - Intronic
1187470715 X:19567097-19567119 CAGAGGTTAGGGAAGGGGGTGGG + Intronic
1187704295 X:21993978-21994000 AAGGGGGAAAGGAGGGAGGGAGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189601212 X:42628672-42628694 GAGACTGTAAGCAGGGAGGTAGG - Intergenic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1189667363 X:43370985-43371007 GAGAGGGAGAGGAGGGAGGGAGG + Intergenic
1189778044 X:44487812-44487834 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1190055045 X:47176372-47176394 GACAGGGAACGGAGGGAGGTCGG - Intronic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190367424 X:49709379-49709401 CAGGGGGTAAGGGGGTGGGTGGG + Intergenic
1190469993 X:50769216-50769238 GAAAGGGGAAGGAGGGAGGGAGG + Intronic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1190634211 X:52418497-52418519 GAGAGGCAAAGGAGGGAGGGAGG + Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1192057069 X:67783920-67783942 CAGAGAGCAAGGAGGGAGAGTGG - Intergenic
1192143161 X:68661930-68661952 GAGAGAGGAAGGAGGGAGGGAGG - Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192190393 X:68987873-68987895 CAGAGGCTTAGAAGGAAGGTAGG + Intergenic
1192353174 X:70373339-70373361 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1192824953 X:74685577-74685599 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1192848062 X:74925762-74925784 GAGAGGGTAAGGAGAGCGGGAGG - Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193682198 X:84535753-84535775 TAGAGGGTAAGAAGGTAGGAGGG + Intergenic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1194755169 X:97730827-97730849 CAGAACGTAATGAGTGAGGTAGG - Intergenic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1195708574 X:107756612-107756634 CTGAGAGGAAGGAGGGAGGGAGG - Intronic
1195908054 X:109864849-109864871 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196216156 X:113054305-113054327 CAGAGGCTAGGGAGGGTGATGGG + Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197338984 X:125243184-125243206 CAGAGGCTAAGGCGGGAGAATGG + Intergenic
1197446933 X:126562228-126562250 CAGGGGTTAAGGAGGGGAGTGGG + Intergenic
1197546649 X:127833288-127833310 TAGAGGCTAGGCAGGGAGGTGGG - Intergenic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197816006 X:130499427-130499449 GAGAGGGTAGGAAGGGAGGAAGG - Intergenic
1198107911 X:133478510-133478532 CAGAGGGCAAGGTGAGAGTTTGG + Intergenic
1198114906 X:133535603-133535625 CAGAAGGAAGGCAGGGAGGTGGG + Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1198791319 X:140349931-140349953 CAGAGTGTGAGGAGAGTGGTAGG - Intergenic
1199264767 X:145817764-145817786 GAGAGGGGAAGAAGGGAGGGAGG - Intergenic
1199429837 X:147746291-147746313 AAGAGAGTTAGGAGGGAGTTAGG - Intergenic
1199686659 X:150271180-150271202 CAGAGGGGGAGGAGGTAGATTGG + Intergenic
1199963757 X:152801076-152801098 CAGATGGTGGGGAGGGAGGGAGG - Intergenic
1200087238 X:153613208-153613230 CAGGGGGTGAGGAGGGGGGGGGG + Intergenic
1200406807 Y:2820297-2820319 CAGAGGCTAGGGAGGGTAGTGGG - Intergenic
1200427299 Y:3035273-3035295 GAGAGAGAAAGGAGGGAGGGAGG - Intergenic
1201303542 Y:12531326-12531348 CAGAGGCTGAGGACAGAGGTGGG + Intergenic
1201438682 Y:13985729-13985751 CTGATGGTGAGGAGGGAGGGAGG - Intergenic
1201445891 Y:14056979-14057001 CTGATGGTGAGGAGGGAGGGAGG + Intergenic
1201517636 Y:14835316-14835338 AAGAAGGGAAGGAGGGAGGAAGG + Intronic
1201652285 Y:16302751-16302773 AAGGAGGGAAGGAGGGAGGTTGG + Intergenic
1201940628 Y:19455162-19455184 CAGAAGGTAAAGAGTGAGATGGG + Intergenic
1201965873 Y:19734808-19734830 TAAAGAGTAAGGAGGAAGGTAGG + Intronic