ID: 1171458278

View in Genome Browser
Species Human (GRCh38)
Location 20:25283932-25283954
Sequence AGGGGTCTTCTCATGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171458278 Original CRISPR AGGGGTCTTCTCATGGGAAA AGG (reversed) Intronic
901479012 1:9511385-9511407 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
902513066 1:16976582-16976604 AGGGGTCTCCTCAGGGCAAGGGG + Intronic
903645996 1:24896891-24896913 AGGGGACCTATCATGGGAAGGGG - Intergenic
903982450 1:27199175-27199197 AGGGGACTTCTGAGAGGAAAAGG + Intergenic
904053784 1:27656932-27656954 AGAGGTCTTCTAATTGCAAACGG + Intergenic
904944960 1:34192466-34192488 AGAGGTCTTGGCATGGGTAAAGG + Intronic
905532006 1:38687352-38687374 TGGGGTGGTCTCATGGGAATGGG - Intergenic
907194954 1:52679090-52679112 AGGGATCATCTCATGGGAGTGGG + Intergenic
910604551 1:89068602-89068624 AGGGGTTTTATTTTGGGAAAAGG + Intergenic
911735179 1:101329144-101329166 AAGGGTCTTCTCAGTGCAAAGGG + Intergenic
912365488 1:109130101-109130123 CTGGGTCTTCTCATGGCATAAGG + Intronic
912638491 1:111320997-111321019 AGGTGTCATCTCCTGAGAAAGGG - Intergenic
914384165 1:147151453-147151475 AGGGGTCCTCCCATGTGAATGGG - Intergenic
914938480 1:152001365-152001387 AGTTGTCTTCTCCTTGGAAAAGG - Intergenic
915039643 1:152957900-152957922 AGGGCTTCTCTGATGGGAAAGGG + Intergenic
917500245 1:175579060-175579082 ATGGGACTTATGATGGGAAATGG - Intronic
918702752 1:187626161-187626183 AGGGGACTTCCCAGAGGAAAAGG + Intergenic
919348748 1:196420664-196420686 AGGAGTTTCCTCATGGGAAATGG - Intronic
920350428 1:205334566-205334588 AAGGGTTTCCTCATGTGAAATGG - Intergenic
921160179 1:212466907-212466929 AGGTGTCTTCCCAGGGGAAGTGG + Intergenic
923483667 1:234408415-234408437 AGGGGGTTTGTCTTGGGAAAGGG - Intronic
1062928326 10:1335101-1335123 TGAGGTCTTCTCAGGGGCAATGG + Intronic
1064766950 10:18684865-18684887 AGGGGATTTGTCTTGGGAAAGGG - Intergenic
1065355404 10:24835473-24835495 TGAGATCTTATCATGGGAAAGGG - Intergenic
1065783684 10:29193472-29193494 AGGGGGATTCTGATGGGAACAGG + Intergenic
1067399879 10:45961977-45961999 AGGGGGTTTCTTTTGGGAAAGGG - Intergenic
1067868207 10:49931276-49931298 AGGGGGTTTCTTTTGGGAAAGGG - Intronic
1067935802 10:50611368-50611390 AGTGGCTTTCTCATGTGAAATGG - Intronic
1068323027 10:55444748-55444770 AGGTGGCTTCAAATGGGAAATGG - Intronic
1073790178 10:106932066-106932088 GGGGATGTTCTCATGGGGAAAGG + Intronic
1074321813 10:112410365-112410387 AGAGATGTTCTCACGGGAAAGGG + Intronic
1074675926 10:115850946-115850968 AGGGGTCTTCTCTTGGCTATTGG + Intronic
1075304190 10:121353310-121353332 AGTTTTCTTCTCATTGGAAATGG + Intergenic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1077316650 11:1922313-1922335 AGAGGGGTTCTCATGGGGAATGG + Intronic
1077800162 11:5529031-5529053 ACGTATCTTCTCATGGAAAAAGG - Intronic
1078440826 11:11365841-11365863 AGAGTTCCTCTTATGGGAAATGG - Intronic
1078679246 11:13460349-13460371 GGGGGTCTTCACTTGGGATAAGG - Intronic
1081481976 11:43497942-43497964 AGGGGACATCTGATGGGGAATGG - Intergenic
1081783669 11:45731379-45731401 AGGGTTCTTCCCTTGGGAATGGG - Intergenic
1081866998 11:46365715-46365737 AGGTGTCCCCTCATGGGACATGG - Intronic
1082744994 11:56951391-56951413 AGGGAAGTTCTCATGGGACAGGG + Intergenic
1085413202 11:76303768-76303790 AGGGGTAATCTCAGGGGACAGGG + Intergenic
1086399707 11:86450441-86450463 AAGGGTCTTCTCTTGGGAGCTGG - Intronic
1087689122 11:101298667-101298689 AGGTGTCTTCTCTTAGGTAAGGG - Intergenic
1087887019 11:103493476-103493498 AGGGGGTTTGTTATGGGAAAGGG - Intergenic
1089534907 11:119154929-119154951 AGGGGTATCCTGGTGGGAAAGGG - Intronic
1090716069 11:129432525-129432547 GTGGGTGTTCTCCTGGGAAAGGG - Intronic
1096253850 12:50051094-50051116 AGGGGTCTTCCTATGGGGGATGG + Intergenic
1097781561 12:63712343-63712365 AGGGGTCATCTCTAAGGAAATGG + Intergenic
1098374268 12:69796873-69796895 AAGTGTCTTCTCATGGAACATGG + Intronic
1102134397 12:110561085-110561107 AGGGGCCATCTAATGAGAAAGGG + Intronic
1103340097 12:120216538-120216560 ATGGTTCTTCTCAGGGGAATGGG + Intronic
1103563701 12:121805054-121805076 AGGGGTCTGCCCATGGGGAGGGG + Intronic
1103673652 12:122638971-122638993 AGGGGTCATCTCCAGGAAAATGG + Intergenic
1104090922 12:125517069-125517091 AGGGGTCCCCTGATGGGAAGGGG + Intronic
1105255696 13:18742984-18743006 TGGGGGCTTCCCATGGGAATTGG - Intergenic
1105348727 13:19597596-19597618 AGGGGGTTTCTTTTGGGAAAGGG - Intergenic
1108145805 13:47475430-47475452 AGGGGTCTGCTAATGAGCAAAGG - Intergenic
1111461343 13:88546351-88546373 ATGTGTCTTCTTATGGCAAAAGG + Intergenic
1112669784 13:101621736-101621758 AAAAGTCTTCTCTTGGGAAAAGG + Intronic
1115816237 14:37167537-37167559 AGGGGTTCTGTCTTGGGAAAGGG - Intronic
1117249183 14:53918375-53918397 AGGTGTCTTCACATGGTAAAAGG + Intergenic
1117830576 14:59745820-59745842 AGGGGTCTTCTCTTGGGTAGTGG + Exonic
1119196758 14:72722901-72722923 AGGGGTCCTCGGATGGGACAAGG - Intronic
1119638233 14:76293889-76293911 AGGGGATTTCTCAGGAGAAAGGG + Intergenic
1119690106 14:76664957-76664979 AGGTGTCTTCCCAAGGGAAAAGG + Intergenic
1120475419 14:84980554-84980576 GGGGGTCTTTTCTTGGTAAATGG + Intergenic
1121403881 14:93706261-93706283 TTGGGTTTTCTCATGGGTAAAGG - Intronic
1127268834 15:57382795-57382817 AGGGGTCCTCACTTGGAAAATGG - Intronic
1129003859 15:72355943-72355965 AGAAGTCTTCTCCTGGCAAAGGG + Intronic
1130099965 15:80885877-80885899 AGGGCTGTTCACATGGGCAAAGG + Intronic
1136535907 16:30899401-30899423 GGGGGTCTTCTGGTGGGAAAGGG - Exonic
1137863852 16:51873449-51873471 AGGTGTCTTCACATGGCACAAGG - Intergenic
1138676469 16:58655085-58655107 AGGGCTGTGGTCATGGGAAAAGG - Intergenic
1138771597 16:59671030-59671052 AGGGGTTTTGTTTTGGGAAAGGG + Intergenic
1138832282 16:60389436-60389458 AGTTGTCTTCTCTTGGGTAAAGG + Intergenic
1139287397 16:65827809-65827831 AGGGGTCTGGTCATGGGGACTGG - Intergenic
1139428800 16:66900180-66900202 AGGGGGCTTATCTTGGGAAGTGG + Intergenic
1139605912 16:68018284-68018306 AGGGGGTTTCTTTTGGGAAAGGG + Intronic
1140829783 16:78740491-78740513 AGGGATCTTCTCATGGTCAGAGG - Intronic
1141752986 16:85971873-85971895 AGGGGTTTTCTTGTGGGAAAGGG - Intergenic
1142032824 16:87846916-87846938 CGGTGTCTTCCCCTGGGAAATGG - Intronic
1142426658 16:90005214-90005236 AGAAGTGTGCTCATGGGAAATGG + Exonic
1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG + Exonic
1142951102 17:3480720-3480742 AGGGGGCTTGTTTTGGGAAAGGG + Intronic
1143600753 17:7944285-7944307 TGGGCTCTACCCATGGGAAAGGG - Intronic
1147181772 17:38691019-38691041 AGGGCTGTGCTCAGGGGAAATGG + Intergenic
1147501590 17:40969912-40969934 AGAAGTCTTCTCATGGCAGAAGG - Intergenic
1148018203 17:44537253-44537275 TGGGGACTTCTGAAGGGAAAGGG + Intergenic
1150865908 17:68849758-68849780 AGGGGTCTACACATGGCAGAGGG + Intergenic
1151220120 17:72605957-72605979 AGGGGTCTTCTCATATTAACTGG - Intergenic
1153573985 18:6502447-6502469 AGAGGACATCTCATGGGAAGTGG - Intergenic
1156092713 18:33490606-33490628 AGTGGATTTCTCATGTGAAACGG + Intergenic
1157575784 18:48742149-48742171 AGGGCTTTTCTCATGGGCCAGGG + Intronic
1160063206 18:75550708-75550730 AGGGGTCATCTTCTGGGCAAGGG - Intergenic
1161025685 19:2035688-2035710 AAGGGTCTCCTCCTGGGAGAGGG - Intergenic
1163110735 19:15159883-15159905 AGGGGGCTGCTGGTGGGAAATGG - Exonic
1163691989 19:18743214-18743236 CGGGGTCTGCTGATGGGGAATGG - Intronic
1164609826 19:29624366-29624388 TGAGGTCTTCTCAGGGGAAAAGG + Intergenic
1165399331 19:35587780-35587802 AGGGGTCTTCTCATTTGAGCTGG + Intergenic
1165894611 19:39133987-39134009 AGGGGTCTTCACCTGGGGACGGG - Intronic
1166753016 19:45173740-45173762 AGGGGGCCTGTCATGAGAAACGG - Intronic
1168005313 19:53482118-53482140 ATGGCTTTTCTCATGGGAGAGGG + Intronic
924988590 2:292158-292180 AGAGGACTTTTCATGGGGAAAGG + Intergenic
926716120 2:15925158-15925180 AGGAATCTTCCTATGGGAAATGG - Intergenic
927392251 2:22608821-22608843 AGGAGGCTTCTCAGAGGAAATGG - Intergenic
927446675 2:23168741-23168763 AGGGCTCTTCTCAAGGCACAAGG - Intergenic
927466089 2:23337742-23337764 AGGGCTCTTCCCTTGTGAAAGGG + Intergenic
929023739 2:37579067-37579089 CTGGGTCTTCACATGGCAAAAGG + Intergenic
929487430 2:42367428-42367450 TGGGGTCTTCTCCCGAGAAATGG + Intronic
930070778 2:47364452-47364474 AGGGCTTTTTTCATGGTAAAGGG + Intronic
930203107 2:48563159-48563181 AGGGGATTTCCCATGGGAATGGG - Intronic
932194992 2:69775627-69775649 TAGGGTCTTTCCATGGGAAAGGG + Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935322599 2:101903507-101903529 AGGATTCTTTTCATGGGAAATGG + Intergenic
935590805 2:104844378-104844400 AGGGTCCTTCTCTTGGGAGAGGG - Intergenic
936541575 2:113355985-113356007 AGGGGTTTGCTCAGGGGTAATGG + Intergenic
938278622 2:130049694-130049716 TGGGGTCTTCCCATGGGAATAGG - Intergenic
938329598 2:130440553-130440575 TGGAGTCTTCCCATGGGAATAGG - Intergenic
938360350 2:130680950-130680972 TGGGGTCTTCCCATGGGAATAGG + Intergenic
938436752 2:131287658-131287680 TGGGGTCTTCCCATGGGAATAGG + Intronic
938628426 2:133137854-133137876 AGGTGTGTTCTCATGGCAACTGG - Intronic
938851712 2:135267288-135267310 ACAGGTCATCTCATGGGGAAGGG + Intronic
939064946 2:137471601-137471623 AGGGGTCATCACATGGGAAGAGG + Intronic
940965178 2:159829180-159829202 AGGGGTCTTGCCTTGGGAGATGG - Intronic
942637865 2:178028040-178028062 AGGCATCTTCTACTGGGAAAAGG + Intronic
943075746 2:183191966-183191988 AAGGGTCTTAATATGGGAAAGGG + Intergenic
943139726 2:183966636-183966658 AGGGATTTTCTGTTGGGAAATGG + Intergenic
943618813 2:190124184-190124206 AGGGGACTTATCAGGGGAATTGG - Intronic
944506534 2:200418202-200418224 AGGGGCTTTCTCACCGGAAAAGG + Intronic
944689009 2:202142602-202142624 AGGGGACTTGTTTTGGGAAAGGG + Intronic
945016092 2:205518467-205518489 AGGTGTCATTTCATGTGAAATGG + Intronic
945739942 2:213647085-213647107 AGGGTTGTTCTCTTGGGAGAGGG + Intronic
946176760 2:217927102-217927124 TGGGGACTTCTCAATGGAAATGG - Intronic
947118797 2:226797119-226797141 CGGGGTCTTCTGGTGGGTAATGG + Exonic
947787390 2:232835868-232835890 AGGGATATTCTCAGGGCAAACGG - Intronic
948268450 2:236656297-236656319 AGGGGTCAGCTCCTGGGAAGAGG - Intergenic
1170946579 20:20896292-20896314 CGGGGACTTCTATTGGGAAAAGG + Intergenic
1171458278 20:25283932-25283954 AGGGGTCTTCTCATGGGAAAAGG - Intronic
1172315991 20:33954827-33954849 AGGGGTCTGTCCATGGGACATGG + Intergenic
1172634715 20:36402176-36402198 AGGGCTCTACTGATGGGAATAGG + Intronic
1175168162 20:57061073-57061095 ACTGGTGGTCTCATGGGAAAGGG - Intergenic
1176841715 21:13848014-13848036 TGGGGGCTTCCCATGGGAATTGG - Intergenic
1179451909 21:41473639-41473661 GGGGGTCTCCTCTTGGGGAAGGG + Intronic
1183332320 22:37228282-37228304 AGGGGTCTTCATGTGGGAGAAGG - Intronic
1183681703 22:39334682-39334704 AGTGGTATTGTTATGGGAAAGGG + Intergenic
1184257296 22:43294551-43294573 AGAGGTGTCCTCATGGAAAAGGG + Intronic
1184846108 22:47088243-47088265 TGGTTTCTTTTCATGGGAAACGG - Intronic
1185297061 22:50059628-50059650 CGGGGTCTGCTCCTGGGAATGGG - Exonic
949335246 3:2967484-2967506 ATGGGGTTTCTTATGGGAAAGGG + Intronic
953283172 3:41578696-41578718 AGGAGTCTTGTGGTGGGAAAAGG + Intronic
953405549 3:42658009-42658031 CTGGGTCATCTCCTGGGAAATGG - Intronic
953484783 3:43285615-43285637 AGGGGTCCTTTCTTGGGGAAGGG + Intergenic
953889604 3:46742508-46742530 TGGGGTGTTGTCCTGGGAAAAGG - Exonic
954627975 3:52033081-52033103 AGGGGTCCTCACACGAGAAAAGG - Intergenic
958530846 3:95328890-95328912 TGAGGTCTTATCATGGGGAAGGG + Intergenic
959090301 3:101895518-101895540 AAGGGTCATCTCATGGTGAAAGG - Intergenic
959819637 3:110717770-110717792 AGGGGTCTCCCTATGGGACAAGG - Intergenic
961096041 3:124157856-124157878 AGGGGCATTCGCAGGGGAAAGGG - Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
963031170 3:140978410-140978432 ATGGGTCTTCACAAGGCAAATGG - Intronic
964423867 3:156532177-156532199 AGTGGCCATCTCATGGGATAGGG - Intronic
964635836 3:158858130-158858152 TGAGGTCTTATCATGGGGAAGGG + Intergenic
966017666 3:175162248-175162270 ATGTGGGTTCTCATGGGAAAAGG - Intronic
966718879 3:183041011-183041033 AGGGTACTTCTCATGGTGAAAGG + Intronic
971911707 4:32803220-32803242 AGGGGACTACTAATGGGTAAGGG + Intergenic
976010879 4:80487200-80487222 AGGGGAGTTCTCATTAGAAATGG - Intronic
976011301 4:80492750-80492772 AAGGGTTTTCTCCTGGGCAAAGG + Intronic
977414840 4:96720214-96720236 ATGTGTCTTTTCATGTGAAATGG + Intergenic
977510062 4:97951949-97951971 TGAGGTCTTATCAGGGGAAAGGG + Intronic
978638725 4:110843324-110843346 AAGGGGCTTCATATGGGAAAAGG - Intergenic
981621375 4:146703434-146703456 AGGTGTCATCTCATGGCAGAAGG + Intergenic
982845328 4:160245890-160245912 TGAGGTCTTATCAGGGGAAAGGG + Intergenic
983736849 4:171072351-171072373 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
985860496 5:2466855-2466877 CGGGGGCTGCTCATGGGCAAGGG + Intergenic
986488830 5:8268956-8268978 ATGTGTCTGTTCATGGGAAAAGG + Intergenic
987661429 5:20883262-20883284 AGGGGTTTGCTGAGGGGAAAAGG - Intergenic
988762156 5:34322063-34322085 AGGGGTTTGCTGAGGGGAAAAGG + Intergenic
989236907 5:39158531-39158553 GGTGGTATACTCATGGGAAATGG + Intronic
989632723 5:43503053-43503075 ATAGGTCTTCACATAGGAAAAGG + Intronic
991030349 5:62076137-62076159 AGGGGTTTTGTTTTGGGAAAGGG - Intergenic
992527516 5:77627761-77627783 AGAAGTCTTCCCGTGGGAAAAGG + Intergenic
993171856 5:84430067-84430089 TGAGGTCTTTTCAGGGGAAAGGG + Intergenic
995061616 5:107816967-107816989 AGTGGTCTACTCTTAGGAAAGGG + Intergenic
995066652 5:107870251-107870273 AGGTGTCATGTCATGGGAAGTGG - Intronic
995183355 5:109248993-109249015 TGGGGCCTGCTCATGGGAGAAGG + Intergenic
997414057 5:133711504-133711526 AGGTCTCTTCCCATGGGAAAAGG + Intergenic
997420278 5:133761508-133761530 CTGGGTTTTCTCAGGGGAAATGG - Intergenic
999846327 5:155484640-155484662 AGTGGCCTTATCATGGGATAAGG - Intergenic
1000606305 5:163331234-163331256 AGGTGTGTTCTCATGGCAACCGG - Intergenic
1001194056 5:169655448-169655470 AGGAGTCCTTTCATGGGGAAAGG + Intronic
1001882143 5:175253658-175253680 AGGGGTCTTCACAGAGGTAAAGG + Intergenic
1002408584 5:179055293-179055315 AGGGGTCAAGTCATGGGACAGGG + Intergenic
1003473034 6:6454446-6454468 AGGGGATTTATCATGGGAACTGG - Intergenic
1003709321 6:8571522-8571544 TGGGGCCTGCTCATTGGAAATGG - Intergenic
1004120186 6:12814038-12814060 ATGTGTCTTCACAGGGGAAATGG - Intronic
1005395332 6:25376885-25376907 TGAGGTCTTTTCAAGGGAAAGGG + Intronic
1007221713 6:40284023-40284045 ATGTGTCTTGTCTTGGGAAATGG + Intergenic
1007818058 6:44538777-44538799 AGTGGTCTTCTCACAGGGAAAGG - Intergenic
1008927919 6:56906675-56906697 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1010150644 6:72727952-72727974 CAGGGTCTTCTCATGGCAAAAGG + Intronic
1010373490 6:75138955-75138977 ACGGGTCCTATCATGAGAAAAGG + Exonic
1010573291 6:77504408-77504430 AGGGGTCTTCCAAGTGGAAAAGG + Intergenic
1014893760 6:126874085-126874107 TGGTGTCATCTCATGGCAAAAGG - Intergenic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1016561147 6:145396301-145396323 AGAGATCTTCAGATGGGAAAGGG - Intergenic
1017980513 6:159397378-159397400 AGGGGGCTTATTTTGGGAAAAGG - Intergenic
1018388846 6:163328016-163328038 AGGGGACTTCCCAGAGGAAAAGG + Intergenic
1018484176 6:164223692-164223714 AGGGACCTTCACATGAGAAAGGG + Intergenic
1019317517 7:395594-395616 AGGAGGCTTCTCAAGTGAAAAGG - Intergenic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1019911959 7:4106179-4106201 GGGGGTCATCTCATGGAGAATGG + Intronic
1020215724 7:6188667-6188689 AGGGGTCACATCAAGGGAAAGGG - Intronic
1020330805 7:7015160-7015182 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
1020923282 7:14292283-14292305 CGGGGTCTTCTCTTGCAAAATGG + Intronic
1021517894 7:21507248-21507270 AGGGGAGTTCCCATGGGACAGGG - Intronic
1021674787 7:23069175-23069197 AGGGTTATTCTCATGGCAGATGG - Intergenic
1023522427 7:41061559-41061581 AGGGTTCTTCTCATGGTACCAGG + Intergenic
1023557051 7:41434833-41434855 AAGGGTCTTCCCATGGCAGAAGG + Intergenic
1027641149 7:80735366-80735388 AGGGGTGCTCTCATGGCAACTGG - Intergenic
1028144211 7:87304159-87304181 ATGGGTCATCTCATTGGGAATGG + Intergenic
1028584530 7:92439863-92439885 AGGTGTCTTCACATGGTAGAAGG - Intergenic
1028934416 7:96449161-96449183 AGGAGAGTTCTAATGGGAAAAGG + Intergenic
1029880044 7:103798657-103798679 AGAGATGTCCTCATGGGAAAGGG - Intronic
1031971699 7:128069240-128069262 AAGGGTCTTCTCATCAGAAATGG - Intronic
1034514067 7:151560224-151560246 AGAGGTCTTTTCAGTGGAAAAGG + Intronic
1037530870 8:19772121-19772143 AGGTGTCCTCGCATGGGGAAAGG - Intergenic
1037780614 8:21865922-21865944 AGGAGGCATCACATGGGAAAAGG - Intergenic
1037784223 8:21893042-21893064 AAGGGTCTTCTCCAGGGAAGGGG - Intergenic
1037790223 8:21932579-21932601 TTGGGTTTTCTCATGCGAAAAGG + Intronic
1037891692 8:22627097-22627119 AGGGGTGCTGTCATGGGAAACGG - Intronic
1038323224 8:26548470-26548492 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1041718619 8:60955552-60955574 AAGGGTCATCCCATGGAAAAAGG - Intergenic
1046702411 8:117416425-117416447 AGGGGTGTTCACATTGGAAACGG - Intergenic
1046765156 8:118060971-118060993 ATGGGTGTTCTCAAGTGAAAGGG + Intronic
1047481781 8:125290356-125290378 AAGGGGTGTCTCATGGGAAAAGG + Intronic
1053494902 9:38542872-38542894 TGGGGGCTTCCCATGGGAATTGG - Exonic
1054793166 9:69274780-69274802 AAGGGTCATCCCATGGCAAAAGG + Intergenic
1056474846 9:86944046-86944068 AGGGGAGGTCTCAGGGGAAAAGG + Intergenic
1056707024 9:88959964-88959986 AGGGGGCTGCTCCTGTGAAACGG + Intergenic
1058275822 9:103039347-103039369 TGAGGTCTTATCAGGGGAAATGG - Intergenic
1061103325 9:128509559-128509581 AGGGGTCTTCTGAGAGGAAATGG - Intronic
1062228692 9:135468768-135468790 AGGGGTTTTGTTTTGGGAAAGGG - Intergenic
1186195678 X:7108511-7108533 AGGGGTCTTCTGCAGGGAAGAGG - Intronic
1187433351 X:19244618-19244640 AGGGGACATCTTCTGGGAAAGGG + Intergenic
1188513165 X:30958407-30958429 AGGTGTCTTCACATGGGAGAAGG - Intronic
1190187634 X:48249843-48249865 AGATGTCTTCGAATGGGAAAAGG + Intronic
1190701209 X:52991136-52991158 AGGGGACTTGTTATGGGAATTGG + Intronic
1190768642 X:53496986-53497008 AGGGGTCTTACCAAGGGACAAGG + Intergenic
1191817643 X:65265520-65265542 AGGTCTCATCTCATGAGAAAGGG + Intergenic
1192161538 X:68792117-68792139 AGGGGACTTGTTTTGGGAAAGGG - Intergenic
1192389338 X:70708945-70708967 AGGGTTCTTGAGATGGGAAAAGG - Intronic
1194833189 X:98650503-98650525 AGGTGTCCTCATATGGGAAAAGG - Intergenic
1195792667 X:108606113-108606135 AGTGGTTTTCTCATGAGAACTGG - Intronic
1196633269 X:117968122-117968144 AGGCGTCTTCTCATGTGACATGG - Intronic
1199464079 X:148116353-148116375 TGGGGTCTTCTCATGGGGGTGGG - Intergenic
1199501900 X:148516350-148516372 AGGGGTGTTTTCCTGGGAAAAGG - Intronic