ID: 1171462532

View in Genome Browser
Species Human (GRCh38)
Location 20:25307032-25307054
Sequence AATGTCACCCCTGCTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171462532_1171462540 21 Left 1171462532 20:25307032-25307054 CCTAAGGGAGCAGGGGTGACATT 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1171462540 20:25307076-25307098 TGCCCTGGCACCTTCTGCCCTGG 0: 1
1: 0
2: 6
3: 80
4: 495
1171462532_1171462537 6 Left 1171462532 20:25307032-25307054 CCTAAGGGAGCAGGGGTGACATT 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1171462537 20:25307061-25307083 GGGCCACCAGAGCTGTGCCCTGG 0: 1
1: 0
2: 0
3: 26
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171462532 Original CRISPR AATGTCACCCCTGCTCCCTT AGG (reversed) Intronic
902680344 1:18039618-18039640 AATGCCGCCCCTGCTGCCTTGGG + Intergenic
902680529 1:18041031-18041053 AACATCTCCCCTGCTGCCTTTGG + Intergenic
903231439 1:21924685-21924707 AATGTCACCTCAGCTATCTTGGG + Intronic
904535068 1:31194052-31194074 ACTTTCACCCCAGCTCACTTAGG - Intronic
907385454 1:54122619-54122641 AATCCCTCCCCTGCTCCCTGGGG + Intergenic
907538097 1:55183960-55183982 GTAGTCACCCCTGCTCTCTTTGG - Intronic
909071391 1:70997992-70998014 AAGGTCAGCCCTGCCACCTTAGG + Intronic
913133350 1:115863306-115863328 AGTGTCACCACTGTTCTCTTTGG - Intergenic
916090946 1:161307261-161307283 AATGGCATCTCTGCCCCCTTCGG + Exonic
919932327 1:202229389-202229411 AATGCCTCCCCTGCTCCCCAGGG - Intronic
920317747 1:205091070-205091092 AATGTCGCTTCTGCTCACTTTGG + Intronic
921930360 1:220749322-220749344 AGTGTCCCCCCTTCTCCCATAGG + Intronic
924805191 1:247356277-247356299 AATGTCACTTCTTCTCCCTAAGG - Intergenic
1062949472 10:1487124-1487146 GATTTCAGCCCTGCTCCCCTTGG + Intronic
1064333887 10:14420604-14420626 AAAGTTACCATTGCTCCCTTTGG - Intronic
1070105962 10:73431704-73431726 AATGTCTCCCCTTATCCCATGGG + Intronic
1073460214 10:103661645-103661667 AAAGGCAGCCCTGCTCCCTCGGG + Intronic
1077472257 11:2769573-2769595 CATGTCTCCCCTCCTGCCTTGGG + Intronic
1078552264 11:12288931-12288953 AATGCCAGCCCTGCTCCCTGAGG - Intronic
1080910717 11:36595000-36595022 AATGTCTCCCCTGCACTCTAGGG - Exonic
1083629754 11:64089441-64089463 AATCCCACCCCTGCTCCGTGAGG - Intronic
1084198563 11:67540605-67540627 AAGGGCAACCCTGCTCCCATGGG - Intergenic
1090673823 11:128970711-128970733 GATGTCACCACTGAACCCTTTGG - Exonic
1090832610 11:130429489-130429511 CATGTCACCACTGCCCCCTAGGG + Intergenic
1091119724 11:133046869-133046891 AGTGACACCCCTGCTGCCTTAGG + Intronic
1091389330 12:116467-116489 ATGGTCACCCGTGGTCCCTTTGG + Intronic
1092341883 12:7683924-7683946 TATGTCAAACCTGCTTCCTTGGG - Intergenic
1093370567 12:18359761-18359783 ATGGCCACCCCTGCTCCCCTTGG + Intronic
1097017519 12:55997871-55997893 TTTGTCACCCCTCCTCACTTTGG + Intronic
1097032866 12:56102049-56102071 AACGTAACTCCTGCTCCCTGTGG + Exonic
1099618445 12:84970561-84970583 AATGCAACCCTTGCTCTCTTTGG + Intergenic
1101514419 12:105421127-105421149 AATGACACACCTGCTCTCTTTGG + Intergenic
1101530171 12:105566561-105566583 AATCTCTCCCATGCTCCCATGGG - Intergenic
1107409384 13:40144321-40144343 AATTTCAATCCTGCTTCCTTAGG - Intergenic
1112004160 13:95240044-95240066 ATTTTCCCCCCTCCTCCCTTTGG - Intronic
1114568160 14:23647433-23647455 TGTGTCACCCCTTCACCCTTTGG - Intergenic
1115190588 14:30743727-30743749 AAAGTCACACCTGCTTCCTGGGG - Intergenic
1122313806 14:100813882-100813904 GATGACACCCCAGCTTCCTTTGG + Intergenic
1124197395 15:27644500-27644522 CCTGTCACCTCTGCCCCCTTAGG + Intergenic
1124420254 15:29514942-29514964 AATGTCACCCATGCTCCCAAGGG + Intronic
1126812458 15:52421486-52421508 AATGTCTCTCCTGCTTACTTTGG - Intronic
1127302062 15:57664391-57664413 AATGTCACCTCTGATTCCCTAGG - Intronic
1129978435 15:79844248-79844270 AGTGTCACACCTGCTTCCCTTGG - Intronic
1131992910 15:98108048-98108070 AAGCTCACTCATGCTCCCTTTGG + Intergenic
1132387310 15:101409634-101409656 CATGACACCCCTCCTGCCTTAGG + Intronic
1135120708 16:19764042-19764064 AATGGCTCCCCTGCCCTCTTTGG - Exonic
1135640638 16:24116872-24116894 AATGTCACCCCAGCTGCCCCAGG - Intronic
1136692248 16:32040267-32040289 GAGGACACCACTGCTCCCTTAGG + Intergenic
1136792745 16:32983496-32983518 GAGGACACCACTGCTCCCTTAGG + Intergenic
1136877111 16:33870558-33870580 GAGGACACCACTGCTCCCTTAGG - Intergenic
1137870516 16:51945861-51945883 AAGGTAACCCCTGCTCCATGGGG - Intergenic
1137872456 16:51963542-51963564 ACTGTCACCACTGCTCATTTGGG + Intergenic
1138098107 16:54229459-54229481 AATGTGGTCCATGCTCCCTTTGG + Intergenic
1138617723 16:58184161-58184183 AATGACAGCCCTGGCCCCTTGGG + Intronic
1140184761 16:72758314-72758336 TATAGCTCCCCTGCTCCCTTTGG + Intergenic
1141185137 16:81781568-81781590 AATTCCACCCCTGCTCCTTTAGG - Intronic
1141185316 16:81782914-81782936 AATTCCACCCCTGCTCCTTTAGG + Intronic
1142186183 16:88695741-88695763 GAAATCAGCCCTGCTCCCTTGGG + Intergenic
1203095001 16_KI270728v1_random:1245184-1245206 GAGGACACCACTGCTCCCTTAGG + Intergenic
1142780976 17:2180954-2180976 CATTTCATTCCTGCTCCCTTGGG + Intronic
1144784295 17:17823382-17823404 ACTGTCACACCTTCTCCCTCGGG + Intronic
1144941980 17:18948228-18948250 AATGACCCCCCTCCTCCCCTGGG - Intergenic
1145279146 17:21455677-21455699 CATGTCACCACAGCTCCCTGGGG - Intergenic
1146791108 17:35751065-35751087 AGTCTCACCCCTGCCACCTTTGG + Intronic
1147302608 17:39541811-39541833 AATGACACGTCTTCTCCCTTAGG + Intronic
1148325651 17:46782081-46782103 AAAGGCTCCCCTCCTCCCTTCGG + Intronic
1151426837 17:74036243-74036265 AATATCAGCCCTGCACCCATAGG - Intergenic
1152558844 17:81067882-81067904 ACTGTCACCAGTGCTCCCTAGGG + Intronic
1153950733 18:10055533-10055555 AAAATCACACCTGCCCCCTTGGG + Intergenic
1155236472 18:23824706-23824728 AATGTCACCACAGTTTCCTTAGG - Intronic
1158592256 18:58787868-58787890 GATATCACCCCTTCTCCTTTGGG + Intergenic
1162044841 19:7991765-7991787 GATGTCACCCCTGCAGTCTTCGG + Exonic
1162050196 19:8028355-8028377 AATGTGAGCCCTGCTCTCCTGGG + Intronic
1165078373 19:33293575-33293597 AAGGTCACGGCGGCTCCCTTTGG + Intergenic
1167469422 19:49667066-49667088 GATGTCTTCCCTGCTCCCTGGGG + Exonic
927656986 2:24957385-24957407 AATGTCCCACCTGATCCCTTGGG + Intronic
928440563 2:31288530-31288552 CAAATCACCCCTGCTCCTTTGGG + Intergenic
928797351 2:35038845-35038867 AATGTAACCCCTCCTCATTTGGG + Intergenic
929562810 2:42966380-42966402 TATGCCACCCCTGCTGCCCTGGG - Intergenic
930625967 2:53697955-53697977 AATGGCAGCCCTGCTCCCATGGG + Intronic
937076974 2:119114188-119114210 ACTGTCACCCCTCCTCTCATAGG + Intergenic
937990522 2:127659571-127659593 AATGTCCTCCCTGCCACCTTGGG - Intronic
938442470 2:131348219-131348241 CCTCTCACCCCTGCACCCTTAGG - Intronic
938902149 2:135807408-135807430 AAGCTCTCCTCTGCTCCCTTTGG - Intronic
939826327 2:147019813-147019835 AATATCACCACTGATCCCATTGG - Intergenic
942245951 2:174008343-174008365 GATGTCAGCCCTGGACCCTTAGG - Intergenic
942799288 2:179858286-179858308 AAAGTCACCCTTGTTCACTTAGG + Intronic
943348949 2:186774451-186774473 ATAGGCACCCCTGCTCTCTTTGG - Intergenic
943953733 2:194160680-194160702 AATGTCACTTCTTCTCCCTTAGG + Intergenic
948680974 2:239634460-239634482 ACTGACAACCATGCTCCCTTGGG + Intergenic
1171369077 20:24649001-24649023 AAGGTGACCTATGCTCCCTTGGG + Intronic
1171462532 20:25307032-25307054 AATGTCACCCCTGCTCCCTTAGG - Intronic
1172106598 20:32520794-32520816 CACGCCACCCCTGCTACCTTTGG + Intronic
1172310790 20:33916913-33916935 AAATTCATCCCTGCTCCATTTGG - Intergenic
1172613102 20:36266280-36266302 AATGTCACCCCTACCCCTCTGGG - Intronic
1184450292 22:44578518-44578540 CATGTCTCCTCTGCTCCCTAAGG - Intergenic
1184739480 22:46419124-46419146 CATCTCAGCCCTGCTCCTTTGGG + Intronic
1184868848 22:47220231-47220253 TCTGTCACCCCTCCTCCCTGAGG + Intergenic
950629911 3:14275535-14275557 CAGGTCACCCCCGATCCCTTGGG + Intergenic
950810959 3:15649371-15649393 CAGGTCAGCCCTGCTCCCTATGG + Intergenic
951057560 3:18164986-18165008 TATGTCACATCTGCTTCCTTAGG + Intronic
952075872 3:29696917-29696939 AATGTCTCCCCTGGTCGTTTGGG + Intronic
954269706 3:49498131-49498153 TATGTGACCCTGGCTCCCTTTGG + Intronic
955803227 3:62707172-62707194 AATGTCACCACTGATCTGTTGGG - Intronic
961168887 3:124781788-124781810 AACGTCTCCCCTGCTCTCCTAGG + Intronic
962023740 3:131526694-131526716 GATGTCTTCCCTGCTCCCTGGGG + Intergenic
968088955 3:195888298-195888320 GATGTCCCTCCTGCTCCCTCAGG + Intronic
969323488 4:6427096-6427118 AGTGTCACACTTGCTCCCCTTGG - Intronic
971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG + Intergenic
974007725 4:56575398-56575420 ACTGTCATACCTGCTCCCCTAGG + Intronic
978597317 4:110392303-110392325 AATGTCTCCCCTGTTCCTTCTGG - Intronic
979202582 4:117996123-117996145 ACAGTCAACCCTGCTCTCTTTGG + Intergenic
979530193 4:121762640-121762662 AAAGGCACCCCTGCTTTCTTAGG + Intronic
980683858 4:136200564-136200586 ACTGTCAGCCTTGCCCCCTTAGG - Intergenic
981318097 4:143361698-143361720 AATGCCACCACCGCTGCCTTTGG + Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985630828 5:1013166-1013188 CCAGGCACCCCTGCTCCCTTTGG - Intronic
987570232 5:19647631-19647653 AATGTCATCTCTGCTCCCTGTGG + Intronic
989482529 5:41948559-41948581 AATTTCCCCTCTCCTCCCTTTGG + Intergenic
993420139 5:87691485-87691507 ACAGCCATCCCTGCTCCCTTTGG + Intergenic
994416264 5:99475833-99475855 AAGGTCACCCCTGCTTTCCTGGG - Intergenic
994463704 5:100099339-100099361 AAGGTCACCCCTGCTTTCCTGGG + Intergenic
995340914 5:111058208-111058230 ATTGTCCCCACTGCTCCTTTTGG - Intergenic
995753555 5:115477819-115477841 AATGTCACCCATGCTACATTAGG - Intergenic
996535729 5:124575457-124575479 AATGTTGCCTCTGCTTCCTTAGG + Intergenic
1000293683 5:159894240-159894262 AATGTGATCCCTGCCCTCTTGGG + Intergenic
1001535961 5:172497984-172498006 ATTTTCACCCCTGCTCTCATAGG - Intergenic
1003564749 6:7213654-7213676 AATGTCATCTCTGCTCACTCAGG - Intronic
1008749461 6:54714864-54714886 CATGTCAGCCCTTCTCCATTAGG + Intergenic
1012627490 6:101421508-101421530 AATGTCTCCCTTTCTCCCTTTGG - Intronic
1013940904 6:115660627-115660649 AATATCACCTCTGCTTTCTTGGG + Intergenic
1014372566 6:120629306-120629328 ATAGCCACCCCTGCTCTCTTTGG - Intergenic
1015876095 6:137824348-137824370 AATGCCACGCCTGATCCCTTTGG + Intergenic
1016619376 6:146090575-146090597 AATGTAATCCCTGCCCCATTGGG + Intronic
1018559775 6:165089505-165089527 AATGTCAGCTTTCCTCCCTTAGG - Intergenic
1021522736 7:21553485-21553507 AATGTCACTTCTTCTCCCTCGGG + Intronic
1024409731 7:49026450-49026472 AATGTCAAATCTGCTCCCTGAGG - Intergenic
1026432972 7:70366666-70366688 AATGTCACTACTGCTGCCCTAGG - Intronic
1029126459 7:98298127-98298149 CAAGTCTCCCCTGCCCCCTTGGG + Intronic
1030113969 7:106049417-106049439 AATGCCACCCCGTCTTCCTTGGG - Intergenic
1031621915 7:123944534-123944556 AATGTGACTGCTGCTCCCTGTGG + Intronic
1032128621 7:129211956-129211978 CATGCCACCCCCGCTCCCCTGGG - Intronic
1034473967 7:151272092-151272114 AATGTCACAACTGCTTCCTAGGG - Intronic
1034835973 7:154351862-154351884 CATGGCACCTCTGCTCCCCTGGG + Intronic
1035844282 8:2846437-2846459 CTTGACACCCCGGCTCCCTTAGG + Intergenic
1038095554 8:24305741-24305763 AAGTTCTCTCCTGCTCCCTTTGG + Intronic
1040725026 8:50371844-50371866 ATAGCTACCCCTGCTCCCTTTGG + Intronic
1042774826 8:72418992-72419014 AAAGTCACCCCATCTCTCTTTGG + Intergenic
1046620972 8:116529306-116529328 AATGTCTCCTTGGCTCCCTTGGG - Intergenic
1047438652 8:124857129-124857151 AAACTCACCTCTGCTCCCTGTGG + Intergenic
1052694124 9:31854376-31854398 ACTGCCACCCCGTCTCCCTTTGG + Intergenic
1053022776 9:34707524-34707546 AATTTCACACCTGCTGCCCTAGG + Intergenic
1054877355 9:70110784-70110806 AATGTCACAGCTGCTTCCTAGGG - Intronic
1057404526 9:94756687-94756709 TATGTCACCCCACCTCCCTTAGG - Intronic
1058188560 9:101885577-101885599 AAGGTCACCCCTGATCCATATGG - Intergenic
1058499575 9:105597736-105597758 AAGATCACCCCTGTTGCCTTTGG - Intronic
1059248163 9:112865934-112865956 AATGTCTCTGTTGCTCCCTTTGG + Intronic
1059749907 9:117238121-117238143 AATGATACCCCTGCTCCTTGTGG + Intronic
1061329432 9:129883120-129883142 GATGTCACCCTGGCTCCCCTAGG + Intergenic
1187401767 X:18966770-18966792 AATGTCACCTCTGCCCCAATTGG + Intronic
1189968922 X:46398461-46398483 AATGTCACTCCTGCCCCCTTAGG + Intergenic
1191081726 X:56518692-56518714 AATTACACCACAGCTCCCTTTGG - Intergenic
1195243834 X:102978919-102978941 ATTGTCCCTGCTGCTCCCTTGGG - Intergenic
1197205685 X:123788096-123788118 AATGACACCAATTCTCCCTTGGG - Intergenic
1198568120 X:137926206-137926228 AATGTCACCCTAGCTACCTGGGG + Intergenic