ID: 1171466057

View in Genome Browser
Species Human (GRCh38)
Location 20:25328827-25328849
Sequence AGGTGCTGCTGTGGAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 1, 2: 6, 3: 52, 4: 495}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171466057_1171466066 9 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466066 20:25328859-25328881 ATCAAGTGGCATGGGAGGCATGG 0: 1
1: 0
2: 2
3: 39
4: 251
1171466057_1171466069 27 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466069 20:25328877-25328899 CATGGAGCTTGGTTGGTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 134
1171466057_1171466070 28 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466070 20:25328878-25328900 ATGGAGCTTGGTTGGTCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1171466057_1171466065 4 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466065 20:25328854-25328876 CCAGCATCAAGTGGCATGGGAGG 0: 1
1: 0
2: 2
3: 19
4: 143
1171466057_1171466063 1 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466063 20:25328851-25328873 CAACCAGCATCAAGTGGCATGGG 0: 1
1: 0
2: 1
3: 13
4: 94
1171466057_1171466062 0 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466062 20:25328850-25328872 CCAACCAGCATCAAGTGGCATGG 0: 1
1: 0
2: 4
3: 26
4: 123
1171466057_1171466068 20 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466068 20:25328870-25328892 TGGGAGGCATGGAGCTTGGTTGG 0: 1
1: 0
2: 1
3: 24
4: 261
1171466057_1171466067 16 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466067 20:25328866-25328888 GGCATGGGAGGCATGGAGCTTGG 0: 1
1: 1
2: 3
3: 43
4: 417
1171466057_1171466059 -5 Left 1171466057 20:25328827-25328849 CCTTCTCTTCCACAGCAGCACCT 0: 1
1: 1
2: 6
3: 52
4: 495
Right 1171466059 20:25328845-25328867 CACCTCCAACCAGCATCAAGTGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171466057 Original CRISPR AGGTGCTGCTGTGGAAGAGA AGG (reversed) Intronic
900148337 1:1167812-1167834 AGGGGCTGCTGTGGAAGCCCAGG - Intergenic
901258254 1:7850633-7850655 AGGAGCTGCTGGGGAAAAGAAGG + Intronic
901812639 1:11776593-11776615 CGCTGCTGCTGTGGAAGATGCGG + Exonic
902471110 1:16647978-16648000 ACGTGCTGCTGCGGGTGAGACGG + Intergenic
902487693 1:16759467-16759489 ACGTGCTGCTGCGGGTGAGACGG - Intronic
902758581 1:18566044-18566066 AGGTGCTCCTGTGGATGGGGTGG - Intergenic
903178519 1:21594106-21594128 AGGGGCTGCTGTGGCAGAGCAGG - Intergenic
903285606 1:22275008-22275030 GGCTGCTGCTTTAGAAGAGAGGG + Intergenic
903376152 1:22867446-22867468 TGGTGTTGCTGTGGCTGAGAGGG + Intronic
903952529 1:27004640-27004662 AGCTGCTCCCTTGGAAGAGACGG + Intergenic
904002686 1:27347839-27347861 TGAGGCTGCTGTGAAAGAGAAGG + Exonic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
905094147 1:35454691-35454713 AACTGCTGCTGTGTCAGAGAGGG - Intronic
905533315 1:38699480-38699502 AAGTGCTTGTGTGGAAGGGATGG - Intergenic
905540031 1:38753247-38753269 AGATGCTGATGAGGAAGAGAGGG - Intergenic
906196089 1:43931680-43931702 TGGGGATGCTGGGGAAGAGAGGG - Intergenic
907775330 1:57508462-57508484 AGGTGCTGCTATTGAGAAGATGG - Intronic
908219713 1:61992905-61992927 ATGTTCTGCTGTCTAAGAGAAGG - Intronic
908627723 1:66064348-66064370 AGGAGCTGATGCAGAAGAGAAGG + Intronic
910530812 1:88233308-88233330 AAGTGCTGCTATGGAGGAAAGGG - Intergenic
910822285 1:91364298-91364320 AGGTGATGGTGTGGAAAAAAGGG + Intronic
910966903 1:92816973-92816995 AGGTGCTGCTGTGGAGGGTGAGG - Intergenic
911425943 1:97712686-97712708 TGGTTCTGCAGTGGGAGAGAGGG - Intronic
911481996 1:98455003-98455025 AGGTGCCCCTGAGGAAGAAAAGG - Intergenic
912475848 1:109934287-109934309 AAGTGCTGCTCTGGCAGAGGAGG - Intergenic
913451459 1:118995431-118995453 AGCTGCTGCTGGGGAAGAGTTGG + Intergenic
914242876 1:145863912-145863934 AGGGGCTGCCATGGAAGACAGGG - Intergenic
914319474 1:146545222-146545244 AGATGCTGCAGTTGGAGAGAGGG + Intergenic
914718062 1:150267865-150267887 GGGTGCTGGTTTGGAAGAGGAGG - Intronic
915292958 1:154898573-154898595 AGGTTTTGCTGTGGATGAGGAGG - Intergenic
915870726 1:159557117-159557139 AGCTGCTGCTGGGGAAGGAAGGG - Intergenic
918312262 1:183293213-183293235 AGGTGCATCTGTGGGAGAAAGGG + Intronic
920365902 1:205448281-205448303 AGGTGCAGCTGCGCAGGAGAAGG + Intronic
920371738 1:205483457-205483479 AGGAGCTGCTGAGGTGGAGAAGG + Intergenic
920986707 1:210897525-210897547 TGGAGCTGCTGTGGAACAGAGGG - Intronic
921740236 1:218676404-218676426 AGGTTCTGCCATGGAAGACAGGG + Intergenic
921973299 1:221174745-221174767 ATGTGATGCTGAGGAAGGGAAGG - Intergenic
922058588 1:222065400-222065422 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
923061403 1:230478013-230478035 AGGTTCTGCTGTTCAAGAGGAGG - Intergenic
924902596 1:248417545-248417567 AGGGGCTACTGTGGAAGAGGTGG - Intergenic
1063066018 10:2609576-2609598 AGGAGCTGCTGAGGAAAAGCAGG - Intergenic
1065837947 10:29676182-29676204 AGGTGCTGCAGGTGAGGAGATGG - Intronic
1065983259 10:30924275-30924297 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1066439145 10:35421274-35421296 GGGAGCTCATGTGGAAGAGAAGG - Intronic
1069604763 10:69732215-69732237 TGGTGCAGCTGAGGGAGAGACGG + Intergenic
1069838351 10:71323690-71323712 AGGTTCTGTTATGGAAGACAAGG + Intronic
1069874166 10:71551532-71551554 AGGTTCTGGTAGGGAAGAGAAGG + Intronic
1069947343 10:71997142-71997164 GGGTTCTGCAGTGGAAGAGTGGG - Intronic
1070784420 10:79154698-79154720 GGCTGCTTCTGTGGAAGAGGAGG + Intronic
1070973693 10:80588134-80588156 AGGTGCTGCAGCTGAGGAGATGG + Intronic
1071073517 10:81724712-81724734 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1071755742 10:88536777-88536799 GGGTGCTGCTGTGAAGGATAGGG - Intronic
1071894100 10:90045702-90045724 TGGTGATGCTGTGGAGAAGAGGG - Intergenic
1072728224 10:97827884-97827906 CGGGGCTCCTGTGGAAGAGACGG - Intergenic
1072877045 10:99183637-99183659 GGGTGCTGCAGTTGAGGAGATGG - Intronic
1073206943 10:101774583-101774605 AGGGTCAGCTGGGGAAGAGAGGG - Intronic
1074442726 10:113492999-113493021 AGGAGCTTATGTGGCAGAGACGG + Intergenic
1074498370 10:113999881-113999903 TGATTCTGCTGTGGAAGAAAAGG - Intergenic
1075307898 10:121384146-121384168 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1075647244 10:124104595-124104617 TGGGGTTGCTGTGGTAGAGAGGG + Intergenic
1076235146 10:128858274-128858296 AGGTGCTGCTGAAGAAGCCAGGG + Intergenic
1076553479 10:131304516-131304538 AGGCACTGCTGAGGAAGAGGTGG + Intronic
1076841558 10:133048467-133048489 AGGTGCTGCTGGTGCAGAGCTGG + Intergenic
1077555446 11:3223911-3223933 AGATGCTGCCGTTGAAGAGATGG + Intergenic
1078458484 11:11494491-11494513 AGTCAGTGCTGTGGAAGAGATGG - Intronic
1078473508 11:11610842-11610864 AGGAGCTGCAGAGGAAGGGAGGG - Intronic
1079271123 11:18987024-18987046 AGTGGCTGCTGTGGGAGATAGGG + Intergenic
1079384649 11:19968027-19968049 AGGTTCTGATCTGGAAGATAAGG + Intronic
1081383881 11:42447951-42447973 AGGTGCTGCTGTTGAGGATATGG + Intergenic
1081876224 11:46410154-46410176 AGGTGCTGCTCTGGTTGAGGAGG + Intronic
1083161678 11:60858330-60858352 AGGTGATGCTGAGGCAGCGAGGG - Intergenic
1083713009 11:64560211-64560233 AGGGGATGCTGTGGCAGAGAGGG - Intronic
1084221225 11:67680898-67680920 AGGGACTGTTGTGGAAGAGGTGG + Intronic
1084904254 11:72333947-72333969 ATGAGCTGCAGTGGAAGGGAGGG + Intronic
1085040133 11:73322105-73322127 AGGAGCAGATGTGGAAGGGAAGG + Intronic
1085633948 11:78143460-78143482 AGGTGCTGCAGAGAAACAGATGG + Intergenic
1085692157 11:78672726-78672748 AGTGTCTGGTGTGGAAGAGATGG - Intronic
1086836667 11:91632616-91632638 AATTGTTGCTGTGGAAGAAAAGG + Intergenic
1087627813 11:100616881-100616903 AGGAGATGTGGTGGAAGAGAAGG + Intergenic
1088724663 11:112623415-112623437 AGGAGCTGCTGTTGAAGATGGGG - Intergenic
1088817821 11:113433483-113433505 AGAGGCTGCTGTGGGAGACAGGG + Intronic
1090150331 11:124377230-124377252 AGGTGCTGCTGCAGGAGAGCTGG + Intergenic
1091170945 11:133519108-133519130 AGGTTCTGCTGGGACAGAGACGG - Intronic
1091225393 11:133954016-133954038 AGGGGCTGCTCTGGCAGAGGGGG - Intronic
1092200428 12:6578897-6578919 AGGTGCTGCTGATGTAGAGAAGG - Exonic
1094348124 12:29494170-29494192 AGGTGATGCTTTGAAAGATAGGG - Intronic
1095723938 12:45431512-45431534 ATGTGCTGCTGTGGACAGGAGGG + Exonic
1095950900 12:47781391-47781413 AGGGGCTGGAGTGGGAGAGAAGG - Exonic
1096884324 12:54701320-54701342 AGGTCCTTCTGAGTAAGAGAGGG + Intergenic
1097100790 12:56587637-56587659 CTGTGCTGCTGAGGGAGAGATGG - Exonic
1097196515 12:57245080-57245102 AGGCTCAGCTGTGGAACAGAGGG - Intronic
1097555991 12:61138349-61138371 AGGTGCTGCTGCTGAGGAAATGG + Intergenic
1098038765 12:66333751-66333773 AGGTGCTGGTGTTGGAGAGATGG + Intronic
1100420027 12:94423912-94423934 CTGTGCTGCTGAGGCAGAGATGG + Intronic
1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG + Intergenic
1101098013 12:101363596-101363618 TGGTGCTGTTGCTGAAGAGAAGG + Exonic
1101431893 12:104633832-104633854 AGATGCAGCTGTGGGACAGAGGG - Intronic
1101587058 12:106094223-106094245 AGGCAATGCTGTGGAAGAAATGG - Intronic
1102444869 12:112994275-112994297 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1102829804 12:115987335-115987357 AGGTGATGGTGAGGAAGAGGAGG - Intronic
1103144287 12:118581018-118581040 AGGTCCTGCTCTGGAACTGACGG + Intergenic
1103615179 12:122147375-122147397 TGTTGCAGCAGTGGAAGAGATGG + Intergenic
1104125386 12:125841202-125841224 AGATGCTGCAGTGGAGGAGATGG + Intergenic
1105045930 12:133003105-133003127 TGGGGCTTCTGTGGGAGAGATGG + Intronic
1105577621 13:21668847-21668869 CGTTGCAGCAGTGGAAGAGAGGG - Intergenic
1106165172 13:27238843-27238865 AGGGGGTACTCTGGAAGAGAGGG - Intergenic
1106459302 13:29954796-29954818 AGGAGCTGCTCTGGAGGAAATGG + Intergenic
1107765880 13:43734041-43734063 AAGTGCTGCTGTGTAAGCCAAGG + Intronic
1108377934 13:49830474-49830496 AACTGCTCCTGTGGGAGAGAGGG - Intergenic
1108411297 13:50150068-50150090 AGGGACTGGTGTGGAAGGGATGG + Intronic
1108430122 13:50344945-50344967 AGGTGCTGCTGAGGCAGGGCTGG - Intronic
1108855621 13:54789379-54789401 AGGTGCTGCAGCTGAGGAGACGG + Intergenic
1111430385 13:88142377-88142399 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1111585622 13:90280310-90280332 AACTACTGCTGTGGAAGAAAAGG - Intergenic
1113610758 13:111643487-111643509 AGGTGCTGAGGTGAAAGAGTTGG + Intronic
1113617351 13:111690186-111690208 AGGTGCTGCTGTAGATGACCAGG - Intergenic
1113622880 13:111775456-111775478 AGGTGCTGCTGTAGATGACCAGG - Intergenic
1115596333 14:34913083-34913105 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1115957482 14:38797636-38797658 AGGTTCTGCTGGAGAGGAGAAGG + Intergenic
1116147554 14:41094859-41094881 AAATGCTGCAGTGGAACAGAGGG + Intergenic
1121250480 14:92496063-92496085 GGGTTCTGCTGAGGAAGAGGAGG - Exonic
1121267805 14:92615680-92615702 AGGGGCAGGTGTGGAAGGGAGGG - Intronic
1121774530 14:96582073-96582095 GTTTGCTGCTCTGGAAGAGAAGG + Intergenic
1122094420 14:99360962-99360984 AGAAGCTGCTGTGGAAGGCAGGG + Intergenic
1122176035 14:99919875-99919897 GGGGGCTCCTGTGGAAGACAAGG + Intronic
1123071336 14:105643942-105643964 AGGTGGTGCTGAGGAAGAGATGG + Intergenic
1123165818 14:106324163-106324185 AGGTGCTGCTCAGGACGAGCAGG - Intergenic
1123796794 15:23780796-23780818 AGCTGCAGCTGAAGAAGAGAAGG + Intergenic
1124062262 15:26305427-26305449 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124062838 15:26310653-26310675 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124372701 15:29112399-29112421 GGGTGCTGGTGTGTAGGAGACGG + Intronic
1124464239 15:29921627-29921649 AGATGCAGCGGTGGAAAAGAGGG - Intronic
1124512229 15:30337014-30337036 AGGTGGTGTTCTGGAAGAAAAGG - Intergenic
1124555299 15:30719556-30719578 GGCTGCTGCTGTGCAGGAGAAGG - Intronic
1124625949 15:31307583-31307605 AGGAGCTTCTGGGGAAGAGGAGG - Intergenic
1124730685 15:32193737-32193759 AGGTGGTGTTCTGGAAGAAAAGG + Intergenic
1127579997 15:60329479-60329501 AGGAACTGCTGTGGGAGGGAGGG - Intergenic
1127893463 15:63275214-63275236 ATGTGGTGCTGTGGAAGCCAAGG - Intergenic
1127980270 15:64029814-64029836 GGGTGCTGCTGTGGTGGAGGAGG + Intronic
1128616988 15:69118024-69118046 AGATGCTGCTGGGGATGGGATGG - Intergenic
1129237609 15:74233156-74233178 AGGTGTTGCTGTGGACCAGGAGG - Intergenic
1129791957 15:78347255-78347277 AGGGGCTGGTGTTGAGGAGAGGG - Intronic
1130693187 15:86104241-86104263 AGGTGCTGGTGTGGTAGGCAGGG + Intergenic
1131544882 15:93307783-93307805 AGGTGCTGCCGTGCAAAAGCCGG + Intergenic
1132016171 15:98319237-98319259 AGGTGCTGCTGTCCAGGAGATGG - Intergenic
1132139991 15:99384365-99384387 AGGTGCTGTTGAGAAAGAGTGGG - Intronic
1132293982 15:100721569-100721591 AGGAGCTGCTGGGGAAAGGAGGG + Intergenic
1132311583 15:100861616-100861638 AGTTGTTGCTTTGGAATAGATGG + Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133993189 16:10726679-10726701 AGGGGCTGCTGTAGAGGGGAAGG + Intergenic
1134827220 16:17294469-17294491 AAGAGCTGCTGTGTAAGGGAGGG + Intronic
1134867255 16:17619628-17619650 AGGTGGTGATGGGGAAGAGAAGG + Intergenic
1135233812 16:20736650-20736672 ATGTGCTGCTGTTGCAAAGAGGG - Intronic
1135847115 16:25928877-25928899 AGCTGCTGCTGTGGTAGGAATGG + Intronic
1136144819 16:28310312-28310334 AGGAGCAGCTGTGGATGTGATGG - Intronic
1136569587 16:31088678-31088700 AGGGACTGCTGGGGCAGAGATGG + Intronic
1137070961 16:35904444-35904466 AGGAGCTGCTGTGGACCACAGGG + Intergenic
1137542763 16:49376461-49376483 AGGGGCTGCCCTGGAGGAGATGG + Intronic
1138299845 16:55916837-55916859 AGCAGCTGGAGTGGAAGAGAAGG - Intronic
1138386800 16:56641006-56641028 AGGTACTCCTTTTGAAGAGAGGG + Intronic
1138414779 16:56865364-56865386 AGGTGCTGCTGTGGGTCAGGTGG - Exonic
1139878226 16:70163512-70163534 CACTGCTGCTGTGGCAGAGAGGG + Intergenic
1140014049 16:71164859-71164881 AGATGCTGCAGTTGGAGAGAGGG - Intronic
1140359337 16:74331300-74331322 CACTGCTGCTGTGGCAGAGAGGG - Intergenic
1140450692 16:75068659-75068681 AGCTGCTGCAGTGGATGAGCAGG + Intronic
1140952325 16:79830936-79830958 AGGTGCTTGTGTGGAAGAAGAGG - Intergenic
1141706574 16:85668428-85668450 AGGGGGTGCTGGGGAAGAGGGGG + Intronic
1141958551 16:87389576-87389598 AGTTGCTGCTTTGTAAGAAATGG - Intronic
1142311809 16:89318434-89318456 AGGTGCTGCTGTGGCGGAAAGGG - Intronic
1142715604 17:1745404-1745426 AGGTGGGGCTGGGGAAGAGTGGG + Intronic
1143463710 17:7121391-7121413 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1143501507 17:7342114-7342136 AGGTGATGCTGTGGAAGAGGAGG + Intronic
1143957898 17:10688501-10688523 TGGTGATGCTGTGGAGGAGCTGG + Intronic
1144506025 17:15831749-15831771 TGATGCAGCTGTGGAAAAGATGG + Intergenic
1145017323 17:19407813-19407835 GGGTGCTGCTGGGGAAGTCAAGG - Intergenic
1145170200 17:20649671-20649693 TGATGCAGCTGTGGAAAAGATGG + Intergenic
1145322269 17:21773529-21773551 AGGTGCTGGTGGGGCCGAGAAGG + Intergenic
1145999395 17:29122279-29122301 AGGCCCTGCTATGGAAGACAGGG + Intronic
1146295570 17:31647486-31647508 AGGTGCTGCGGCAGAGGAGATGG - Intergenic
1146626762 17:34440768-34440790 TGGTGATGCTGTGGGACAGAAGG + Intergenic
1147246237 17:39122982-39123004 ACGGGCTGCTGTGGGAGTGAGGG - Intronic
1147766344 17:42838884-42838906 TGGGGCTGCTGTGGATGACATGG + Intronic
1149828624 17:59851676-59851698 TGGTGGTGCTGTTAAAGAGATGG + Intergenic
1150204232 17:63389516-63389538 TGGTGCTGCTGTGCAAGAAACGG + Exonic
1151143319 17:72016187-72016209 AGATGCTGCGTGGGAAGAGATGG + Intergenic
1151450285 17:74194515-74194537 AGCTGCTGGTGAGGAAGAGGTGG + Intergenic
1151996349 17:77611713-77611735 AGGTGCTGCTGAGGGAGGGAAGG + Intergenic
1152822888 17:82446109-82446131 AGGTGCTGCTCTGTCAGAGCCGG + Intronic
1152898875 17:82928713-82928735 AGCTGGGGCTGGGGAAGAGATGG - Intronic
1153343463 18:4001733-4001755 GGGTTTTGCTGTGGAGGAGATGG + Intronic
1153637789 18:7128169-7128191 AGCTCCTACTGTGGAAGAGAAGG - Intergenic
1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG + Intergenic
1155063379 18:22247927-22247949 TGGTGCTGATGTGGAGGGGAGGG + Intergenic
1155255153 18:23989900-23989922 AGGTGAGGATGTGGAAGAAATGG + Intergenic
1155578103 18:27270931-27270953 AAGTGTTGTTGTGGGAGAGAAGG + Intergenic
1156466530 18:37351101-37351123 AGGTGCTGGTGGGGGAGAGGGGG + Intronic
1156705344 18:39874936-39874958 AGGTGCTGAGGTGGAAGATGTGG - Intergenic
1156745117 18:40381039-40381061 GTGTGCTGATGTGCAAGAGAAGG + Intergenic
1157307307 18:46526524-46526546 AGATGCTGAGGTAGAAGAGAGGG + Intronic
1157475675 18:48021997-48022019 ACTTGCTGCTGAGGGAGAGAGGG + Intergenic
1157773368 18:50370720-50370742 ATATGTTGCTGTAGAAGAGATGG - Intergenic
1159114569 18:64099461-64099483 AGGTGCTGCTGAGGCAGGGTTGG + Intergenic
1159217114 18:65407555-65407577 AGGTGCTGCAGTCGAGGAGGTGG + Intergenic
1159379623 18:67639496-67639518 AGGTGGTGCTTAGGAAGATAAGG - Intergenic
1160389785 18:78521469-78521491 GGGTGCTGCTGAGGCAGAGAAGG + Intergenic
1160417170 18:78719555-78719577 ACCTGCTTCTGTGGAAGAGGAGG - Intergenic
1160979539 19:1810676-1810698 TGGTGGGGCTGTGGGAGAGAAGG + Exonic
1161509961 19:4664796-4664818 AGGAGCTGCTTTGGAAGGCAGGG - Intronic
1161576590 19:5057957-5057979 GGGTGCTGCTGTGTAGGTGAGGG + Intronic
1161708686 19:5834848-5834870 AGATGGTGCTGTGGAGGAGGTGG + Intronic
1161857833 19:6775849-6775871 AGGTGCTCCTGTGGAGGAAATGG + Intronic
1162402520 19:10454526-10454548 AGGGGCACCTGTGGAAGGGAGGG - Intronic
1163253554 19:16141259-16141281 AGGTGCTGCTGTTGCCGAGGAGG + Intronic
1163811044 19:19431868-19431890 GGGTGGTGCTGTGGAAGAAGAGG + Intronic
1168378833 19:55903421-55903443 TGGTGCAGGTGTGGAATAGAGGG - Intronic
1202703507 1_KI270713v1_random:4773-4795 ACGTGCTGCTGCGGGTGAGACGG + Intergenic
925118899 2:1402379-1402401 AGGACCTGCTTAGGAAGAGACGG + Intronic
925185607 2:1844183-1844205 AGGTCCTGCTGTGCTAGGGATGG - Intronic
925203990 2:1991249-1991271 AGGGGCTGATGTGGAAGCGTAGG - Intronic
926242763 2:11101077-11101099 AGGTGGTGCTGAGGAAGTGTGGG + Intergenic
926623620 2:15070872-15070894 AGGTGCTGCTGTGAGATAAAGGG - Intergenic
927884418 2:26709865-26709887 AGGGACTGCTGAGGAAGAGCGGG - Intronic
928260983 2:29766478-29766500 AGGAGGTGGTGGGGAAGAGAAGG - Intronic
928834773 2:35530309-35530331 AGGTGCTGCAGTCAAGGAGATGG + Intergenic
928838737 2:35579693-35579715 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
928899504 2:36302146-36302168 AGGGGCTGCGGAGGTAGAGATGG + Intergenic
928990585 2:37229552-37229574 AGGTGATGCTGGGGAAGGGGTGG + Intronic
929608933 2:43255501-43255523 TGGTGCTGCTGTGAAGGTGAAGG + Intronic
931815673 2:65898187-65898209 AGGGGCTGCTTTCCAAGAGATGG - Intergenic
933286103 2:80386217-80386239 AGGTGGTGGTGGGGAAGGGAAGG - Intronic
933463622 2:82621781-82621803 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934130751 2:88946485-88946507 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934132768 2:88965448-88965470 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934140775 2:89045190-89045212 AGGTGCTGCAGCCGAGGAGACGG - Intergenic
934146418 2:89099046-89099068 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934222849 2:90101529-90101551 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
934228459 2:90155352-90155374 AGGTGCTGCAGCCGAGGAGACGG + Intergenic
934602733 2:95670551-95670573 AGAATCTGCTGGGGAAGAGAAGG + Intergenic
935035591 2:99369411-99369433 ATGTGCTGCTGTAGAAGTTATGG + Exonic
935693854 2:105753728-105753750 AGTTGCTGTTGTTGAAGTGAAGG + Intronic
935743320 2:106170044-106170066 AGGTGCAGCTGGGGAGGAGAGGG - Intronic
935931001 2:108125378-108125400 AGGCCCTGCTGGGGAATAGATGG - Intergenic
935951296 2:108331306-108331328 AGGACCTGCTATGGAAGACATGG + Intergenic
936013486 2:108940978-108941000 AAGAGATGCTCTGGAAGAGATGG - Intronic
936467701 2:112767876-112767898 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
936536115 2:113312743-113312765 AGAATCTGCTGGGGAAGAGAAGG + Intergenic
937468705 2:122157015-122157037 GGGTGCAGCTGTTGAAAAGAGGG + Intergenic
937783248 2:125864623-125864645 AGGTGCTGCAGTAGAGCAGATGG + Intergenic
938452124 2:131430622-131430644 AGGTGCTGTTGAAGAAGAGTGGG - Intergenic
938723763 2:134089020-134089042 AGGAGTGTCTGTGGAAGAGAAGG - Intergenic
939435449 2:142171110-142171132 AGGTCCTCCTTGGGAAGAGAAGG + Intergenic
939833215 2:147097267-147097289 AGGTGAGACTGTGGAAGGGAAGG - Intergenic
942370282 2:175276490-175276512 AGATGCTGGTGCAGAAGAGAAGG + Intergenic
942492338 2:176502041-176502063 AGGTCCTTAGGTGGAAGAGATGG + Intergenic
942659341 2:178247591-178247613 GGGTGCTGTTGTGGCAGTGAAGG - Intronic
943023973 2:182606950-182606972 AGGTGCTGCCGCTGAGGAGATGG + Intergenic
943097407 2:183447059-183447081 AGGTGCTGCAGTGTAAGAAGGGG - Intergenic
944780407 2:203011937-203011959 ACGTGCTACAGTGAAAGAGAAGG + Intronic
945366988 2:208966328-208966350 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
945581635 2:211602401-211602423 AGCTGCTGCTGTGGGGGAGTGGG - Intronic
946510294 2:220348715-220348737 AGGTGCTGCTGGGGATGAACAGG + Intergenic
946822843 2:223647915-223647937 AGGAGGTGGTGAGGAAGAGAGGG - Intergenic
946848881 2:223885813-223885835 ACGTGCTGCTGTGGCTGGGAAGG - Intronic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
947829247 2:233127089-233127111 AGGGGCTGATGAGGAGGAGATGG - Intronic
948288945 2:236810044-236810066 AGGTACTGCAGTTGAAGAGATGG - Intergenic
948705239 2:239787781-239787803 ACGTGGTGCTGTGGCTGAGATGG - Intronic
948763918 2:240209861-240209883 AGGTGAGGCTCGGGAAGAGAAGG - Intergenic
948788199 2:240364010-240364032 ATGTGCTGGTGTGGAGGAGGTGG - Intergenic
949038868 2:241835588-241835610 AGGGACTGCTGAGGAAGAGAAGG - Intergenic
1169792066 20:9421670-9421692 AGGCACTGCTGTGCAGGAGATGG - Intronic
1170557313 20:17525239-17525261 AAGTGCAGCAGTGGCAGAGATGG + Intronic
1170757089 20:19213622-19213644 AGCTGCTGCTGTGGAAGAAATGG + Intronic
1171032694 20:21691589-21691611 AGGTGGTGAAGTGGAAAAGAGGG + Intergenic
1171288194 20:23960810-23960832 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1171357306 20:24557953-24557975 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1171415142 20:24973295-24973317 CAGTGCTGCTGTGGAAAAGTAGG - Intronic
1171466057 20:25328827-25328849 AGGTGCTGCTGTGGAAGAGAAGG - Intronic
1171533603 20:25867846-25867868 GGGTTCTGCTCTGGATGAGAAGG + Intronic
1172151951 20:32796923-32796945 AGGTGCTGTTGGGAAGGAGAGGG - Intronic
1172437966 20:34943485-34943507 AAGGGCTGCTGTGGAGGAGGAGG - Intronic
1172603966 20:36202225-36202247 AGTGCCTGCTGTGGAAGAGCTGG - Intronic
1173237789 20:41263784-41263806 AGGAGCTGCTGCCTAAGAGAGGG + Intronic
1173747390 20:45448353-45448375 GGGTTCTGCTGTGAAGGAGAAGG - Intergenic
1173801587 20:45897835-45897857 AGGGGCTGCTGTGGAGGATTGGG + Intronic
1175169453 20:57070013-57070035 AGTAGCTGCTGTGGCAGGGAAGG + Intergenic
1176160912 20:63648182-63648204 ACCTGCTGCTGTGGAACACATGG - Intronic
1178615738 21:34131442-34131464 AGGAGCTGCTGTTCAAGGGAAGG - Intronic
1178790064 21:35691608-35691630 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1179036030 21:37759419-37759441 AGGTGCTGCTGTAACAGGGATGG - Intronic
1179284630 21:39966928-39966950 AGGTGCTGAAGTGGAGGACAAGG - Intergenic
1179289542 21:40006459-40006481 ACATGCTGCTGTTGAAAAGATGG - Intergenic
1179454665 21:41490840-41490862 AGGTGCAGAGGTGGAGGAGAGGG + Intronic
1179562961 21:42228388-42228410 AGGTGCTGCTGTGGCTGGGGAGG - Intronic
1179829400 21:43987088-43987110 AATTGCTGCTGTGAAAGACAGGG + Intergenic
1179875877 21:44267152-44267174 AGAAGCAGCTTTGGAAGAGATGG - Intergenic
1180993787 22:19954334-19954356 AGGGGCTGGTGTGGAAGGGAAGG - Intronic
1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG + Intronic
1182050998 22:27312457-27312479 AGGTGCTAGTGTGTTAGAGAGGG - Intergenic
1182297255 22:29316855-29316877 AAGTTCTGCTTTGGGAGAGAAGG + Intronic
1182507874 22:30798010-30798032 AGCAGCTGCTGTGGAAAATAGGG - Intronic
1182615370 22:31585234-31585256 TCGTTCTGCTTTGGAAGAGAGGG + Intronic
1182774432 22:32820420-32820442 AGGTGCTGCAGTGGAATGGGTGG - Intronic
1183832719 22:40427206-40427228 AGGGGCTGCTGAGGAATACACGG + Intronic
1183957141 22:41387594-41387616 TGGGGATGCTGTGGAAGAGCTGG - Exonic
1184490280 22:44804315-44804337 AGCTGCTGCTGGGGGAGAGTTGG + Intronic
1184965252 22:47966668-47966690 CCGTGTTGCTGTGGAGGAGAAGG - Intergenic
1185178599 22:49346514-49346536 AGGTGCTGCTGTTGCAGAGGTGG + Intergenic
1185285201 22:49996941-49996963 AGGTCCTGCAGTGGAGGAGATGG + Intronic
949439116 3:4061540-4061562 AGGTGCTGCAGCTGAGGAGATGG - Intronic
949514883 3:4798459-4798481 TGGTGATGCTGTGGATCAGATGG + Intronic
950589573 3:13926953-13926975 ACGTGAGGATGTGGAAGAGAAGG - Intergenic
951252637 3:20411855-20411877 AGGAGCTGCTTTGGTAGAGAGGG + Intergenic
951744180 3:25959107-25959129 AGGTGCTGGAAAGGAAGAGAAGG - Intergenic
952465117 3:33576183-33576205 AGGTTCTGATGTGGAGGAGGCGG - Exonic
952691928 3:36218704-36218726 TGGTGCTGCAGTGGAAAAGTAGG - Intergenic
953244413 3:41177602-41177624 AGAGGCTGCTGTGGACAAGATGG - Intergenic
953804306 3:46054675-46054697 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
953877644 3:46675513-46675535 AGGTGCTTCTGGGGAAGTGCTGG - Intronic
954155053 3:48680808-48680830 AGGTGCTGACATGGATGAGAGGG - Intronic
954298321 3:49686260-49686282 ACGTGCTGCTGCGGGTGAGACGG - Intronic
954331789 3:49895133-49895155 AGGTGGGGCTGGGGCAGAGATGG - Intronic
954430646 3:50469246-50469268 AGATGCTGTTGGGGAGGAGATGG - Intronic
955047079 3:55370549-55370571 AGGTCATGATGTGGAGGAGAAGG - Intergenic
955158204 3:56438419-56438441 AGGTGCTGCAGCTGAGGAGATGG - Intronic
956406936 3:68937675-68937697 AGATGCTGGAGTGGAAGGGATGG - Intergenic
956695963 3:71919699-71919721 AGCAGCTGCTTTGGAGGAGAGGG - Intergenic
956711682 3:72043749-72043771 AGTGGCTGCTGTGGATGGGATGG + Intergenic
956736730 3:72244208-72244230 GGGTGCTTATGTGGAGGAGAGGG - Intergenic
956872112 3:73428302-73428324 AGGTGAGGATGTGGAACAGAGGG - Intronic
957914630 3:86672333-86672355 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
958907717 3:99960392-99960414 AGGAGCAGCTGTGGTAAAGAGGG - Intronic
959527837 3:107397646-107397668 GGGTGTTGCTGTGGAGGAGGGGG - Intergenic
960683635 3:120274745-120274767 AGCTTCTGCTCTTGAAGAGAGGG + Intronic
961059806 3:123818774-123818796 AGGTGCTGCTGAGGAAACTAAGG - Intronic
961127694 3:124435339-124435361 TGATGCTGCTGTGGGAGAAAAGG + Intronic
961514697 3:127425313-127425335 TGTTGTTGCTGTGGAAGGGAAGG - Intergenic
961592119 3:127988863-127988885 AAGTGATGTTGAGGAAGAGATGG + Intergenic
962237558 3:133719436-133719458 AGGTGTTGGTGTGGAAGTGTTGG + Intergenic
962760881 3:138512613-138512635 AGTTGCTGCTGTTGAATACATGG - Intronic
962830715 3:139136788-139136810 AGCCGCTGCTGTTGAGGAGAAGG - Intronic
963236492 3:142962382-142962404 AGGTGAAGATGTGGAAGAGCTGG + Exonic
963262793 3:143209695-143209717 ATGCGGTGCTATGGAAGAGAGGG - Intergenic
963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG + Intergenic
963773490 3:149414717-149414739 GGGTGCTTCTGTGGAAGGCAAGG + Intergenic
964378230 3:156070707-156070729 GGGTGCTGCAGTCGAGGAGATGG + Intronic
964720886 3:159765909-159765931 GGGTGCTGGAGTGGAAAAGAGGG + Intronic
965605559 3:170494894-170494916 AGGTACTGCTTTGGTAGAAAGGG + Intronic
966897055 3:184453105-184453127 AGGTGTCGCTGTGAAAGTGAGGG - Intronic
967374990 3:188791191-188791213 AGGTCCTGCTCTGGGAGAAATGG + Intronic
967606377 3:191451827-191451849 AGGATCTGCTGTGGAATGGAGGG + Intergenic
967889037 3:194351866-194351888 AGATGCTGCTTTGGAAGGGAGGG + Intergenic
968091611 3:195901518-195901540 AGCTGCTGAGGAGGAAGAGAGGG + Intronic
968567084 4:1318673-1318695 AGGTGCTGCTGTGGCCGAGGGGG + Intronic
968709387 4:2102061-2102083 AGGTCCTGCTGTGGGAGTTAGGG - Intronic
969075478 4:4574780-4574802 ATGAGCTGCTGTGAAAGACATGG + Intergenic
969242101 4:5906007-5906029 AGGTGCTGCTGTAAAGGAGGAGG + Intronic
969405942 4:6991748-6991770 GGGGGCTGGTGTGGAGGAGATGG + Intronic
969493274 4:7511955-7511977 ACGCGCTGCTGTGGGAGACACGG + Intronic
971443902 4:26721448-26721470 CGGGGATGGTGTGGAAGAGAGGG - Intronic
972210431 4:36830161-36830183 AGGTTCTGCTGTGGGAGAAGAGG + Intergenic
972613141 4:40673601-40673623 AGTTGCTGCTTTGGAATAGAGGG - Intergenic
974124368 4:57677453-57677475 AGGTCCTGCTGCTGAGGAGATGG - Intergenic
974650483 4:64748387-64748409 ATGCGCTGCTGGGGAAGGGAAGG + Intergenic
974662983 4:64919255-64919277 AGGTGCTGATGTGTCAGTGATGG + Intergenic
975846047 4:78526077-78526099 AGGTGCTGCTGTGACACAGGAGG - Intronic
976348816 4:84036518-84036540 AGATGCGGCTTTGGGAGAGATGG + Intergenic
976633407 4:87263059-87263081 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
976659470 4:87524679-87524701 AGGTGCTGCAGCTGAGGAGATGG - Intronic
978839513 4:113193443-113193465 AGAAGCCGCTGTGGAAGAGAAGG + Intronic
979129082 4:117017209-117017231 ATGTGCTGTTGTGAAAGACAAGG + Intergenic
979447422 4:120831144-120831166 AGATAGTGCTGTGGAGGAGAGGG + Intronic
981500558 4:145446959-145446981 AGCTGATGCTGTGGAAGAAAAGG + Intergenic
981843316 4:149137318-149137340 TGGTCCTGCTGTTGTAGAGATGG + Intergenic
981939447 4:150266454-150266476 AGGTGGTGCAGGGAAAGAGATGG + Intronic
985206967 4:187549439-187549461 AGGTGCTGCAGGCCAAGAGATGG + Intergenic
985245894 4:187979416-187979438 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
985295254 4:188431055-188431077 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
985824418 5:2181900-2181922 AGGTCCTGCTGGGGAAGGGGAGG - Intergenic
985946805 5:3191712-3191734 CGGTGCTTCTGTGGATGCGACGG + Intergenic
985966712 5:3343351-3343373 GGGTGCTGCTGTAGAGGAGCTGG + Intergenic
985972090 5:3386377-3386399 AGCTGCTGCTGGGGGAGAAAAGG + Intergenic
986286043 5:6359967-6359989 GGCTGCTGATGAGGAAGAGATGG - Intergenic
986483592 5:8213476-8213498 AGGTACAGCTGAGAAAGAGATGG + Intergenic
986500440 5:8393196-8393218 AGCTGCTGCTTTTGAAAAGAAGG + Intergenic
986832552 5:11596753-11596775 AGGTGCTGCCTTGGAGGTGAGGG + Intronic
987002200 5:13671256-13671278 AGGTGATGCTGGAGAAGTGAAGG - Intergenic
987221843 5:15798756-15798778 AGGTTCTACTATGGGAGAGAAGG - Intronic
987316609 5:16730390-16730412 AGGTGCTGTGGTGGAAGGGAAGG + Intronic
988045756 5:25950888-25950910 AGGTGCTGCAGTTGAGGACATGG + Intergenic
988404367 5:30805116-30805138 AGGTGCTGCTGTCCACCAGATGG + Intergenic
988566244 5:32321762-32321784 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
991955281 5:71988066-71988088 AGTTGCTGTGGTGGCAGAGATGG + Intergenic
992361387 5:76041963-76041985 AGGAGCTGCTGTGGGTGAGAAGG - Intergenic
993054365 5:82965075-82965097 TGGTGCTGATGTGGGAGTGAAGG - Intergenic
993636489 5:90350820-90350842 ATGTCCTGCTGTAGAAGATATGG - Intergenic
994453285 5:99971309-99971331 GGGTGCTGCAGTCAAAGAGATGG + Intergenic
994571503 5:101520594-101520616 GGGTGCTGCAGCTGAAGAGATGG - Intergenic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
997588744 5:135060245-135060267 AGGGGCCCCTGTGGAAGAGGTGG + Intronic
997657214 5:135564264-135564286 AGGAGCTGGGGTGAAAGAGAGGG - Intergenic
998544157 5:143011740-143011762 AGATGCTGCTGAGGGAGAGTGGG + Intronic
998943121 5:147306407-147306429 AGGTGCTGAAATGGAGGAGAAGG + Intronic
999561403 5:152807532-152807554 AAGTGCTGCTGGAGGAGAGAAGG - Intergenic
999563991 5:152837387-152837409 AGATGATGCTTTGGAAGAGGAGG + Intergenic
1000039076 5:157471753-157471775 ACATGCTCCTGAGGAAGAGAAGG + Exonic
1000540849 5:162538079-162538101 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1000692713 5:164343206-164343228 TGGTGCTGCTTTGGCAGAGTTGG - Intergenic
1000944238 5:167400710-167400732 AGGTGAGTCAGTGGAAGAGATGG + Intronic
1001442822 5:171758441-171758463 ACGGGCTGCTGTGAAGGAGATGG + Intergenic
1002655336 5:180742059-180742081 AGGTTCTGCACTGGAAGATAAGG - Intergenic
1003276561 6:4658890-4658912 AGGTGGTGCCGTGGAGGAGGAGG + Intergenic
1003601975 6:7526050-7526072 TGGTGCTGGTGTGGAAAGGAAGG + Intergenic
1004277580 6:14252262-14252284 ATTTGCTACTGTGGAAAAGATGG + Intergenic
1004341108 6:14808115-14808137 AGGTGCTGCCAATGAAGAGATGG + Intergenic
1005035154 6:21549178-21549200 AGGTGCTGCAGAAGAGGAGATGG + Intergenic
1005218503 6:23559772-23559794 AGCTGGTGCTGTGGAAGGGCAGG + Intergenic
1005695098 6:28344473-28344495 AGGTGCTAGTGTGGTTGAGATGG - Intronic
1005722526 6:28616946-28616968 ACAAACTGCTGTGGAAGAGAAGG - Intergenic
1006000922 6:30964512-30964534 AGGTGTTACTGTGGAAGATGTGG - Intergenic
1006175056 6:32116557-32116579 AGGTGGTCCTGGGGAACAGATGG + Exonic
1006186083 6:32182456-32182478 AGGAGCTGAGGAGGAAGAGAGGG - Intronic
1006275650 6:33003520-33003542 ACCTCCTGCTGTGGAAGAGGGGG - Intergenic
1007828235 6:44617787-44617809 AGGTGCTACTGTGGAAGGGGAGG - Intergenic
1008310198 6:49959184-49959206 AGGTGCTGCAGTGAAGAAGATGG - Intergenic
1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG + Intergenic
1011249898 6:85360110-85360132 TGGTGCTACTGTGGAAAGGAGGG - Intergenic
1012416191 6:99016647-99016669 AAGTGTTGTTGTGGAAGAGTTGG - Intergenic
1012499796 6:99875743-99875765 AGTTGCAGCAGTGGAAGGGATGG + Intergenic
1012806321 6:103898086-103898108 CAGTGCTGGTGTGGAAGAGGTGG - Intergenic
1012976244 6:105784035-105784057 GGGTGCTGCTCTGGAAGAAATGG - Intergenic
1013128156 6:107205782-107205804 AGGAGCTGCTGGAGAAGAGGTGG + Intronic
1014896717 6:126910054-126910076 AGATGCATCTGTGGAAGATATGG + Intergenic
1015054461 6:128883134-128883156 AGCAGCTGCTGGGGAAGAGGAGG - Intronic
1015088928 6:129330851-129330873 AGGTGCAGGTATGGAGGAGATGG - Intronic
1016242651 6:141949687-141949709 AACTGCTGATGTGGAAGAGAAGG - Intergenic
1017383688 6:153858842-153858864 GGGTGCTGCAGTCGAGGAGATGG - Intergenic
1017748251 6:157466320-157466342 GGGTGCTACTGTGGAGCAGATGG - Intronic
1018193647 6:161334948-161334970 AGGAACTGCTGTGGAAGAAGTGG + Intergenic
1018416854 6:163609122-163609144 AGGTGCTGAAGTGGAAGTGGGGG - Intergenic
1018614737 6:165676447-165676469 AGGTGCCGCAGAGGAAGAGGTGG + Intronic
1019303246 7:319758-319780 AGAGGATGCTGTGGCAGAGAAGG + Intergenic
1019783476 7:2958710-2958732 ATGTTCTGCTTTGGAAGAAAAGG + Intronic
1020879805 7:13745887-13745909 TTGTGCTGCTGTGAAAGAGCAGG + Intergenic
1021399319 7:20191480-20191502 AGGTGCTGCTCTGTAGGAGTTGG + Intronic
1021418985 7:20423441-20423463 AGCTGCTGATGTGGAACAGCAGG + Intergenic
1021588697 7:22237671-22237693 AGGTGCTGCAGCGGAGGAGTTGG - Intronic
1022089479 7:27098114-27098136 AGGAGCTCCTGTGGGAGAGGGGG + Intergenic
1022529231 7:31056842-31056864 AGGTGATGAGGTGGATGAGAAGG - Intronic
1023849727 7:44143971-44143993 AGGTGCTGCTCTGGAGAAGTGGG - Intergenic
1024022853 7:45387300-45387322 AGGTGCTTCCGTGGGAGAGGGGG - Intergenic
1024201714 7:47115175-47115197 AGGAGCTTCTGTTGCAGAGACGG + Intergenic
1024307715 7:47942219-47942241 AGGTGCTGCAGATGAGGAGAAGG - Intronic
1024421379 7:49170925-49170947 AGGTGCTGCAGCCAAAGAGATGG - Intergenic
1024484736 7:49905312-49905334 AGTGGCTGCTGTGGTGGAGATGG - Intronic
1024864459 7:53888762-53888784 AGGTGCTGCTGCCAAGGAGATGG + Intergenic
1025260063 7:57412827-57412849 AGAGGCTGCTGTAGAGGAGAAGG - Intergenic
1027162362 7:75811957-75811979 TGGTGAAGCTGTGGAAGAAAGGG + Exonic
1027732428 7:81891789-81891811 AGGGGCTGGTGGGGGAGAGATGG + Intergenic
1027805855 7:82821287-82821309 ATGTGCTGCTGTGGCAGTGTGGG + Intronic
1028455159 7:91030580-91030602 AGGTGCCCCTGTGAAAGAGGAGG + Intronic
1029023665 7:97391514-97391536 AGGTGCTGCAGTGAAGGAGATGG - Intergenic
1029156682 7:98522206-98522228 AGGAGCTGCTGTGGATGAGGAGG - Intergenic
1033249696 7:139747925-139747947 AGTAGCTACTGTGGGAGAGAGGG + Intronic
1033540446 7:142350933-142350955 AGGGGGAGCTGAGGAAGAGAAGG + Intergenic
1033928969 7:146500318-146500340 AGGTGCTACAGTCGAGGAGATGG + Intronic
1034178442 7:149118909-149118931 AGTTACTGCTGTGGAAGACTGGG + Intronic
1035090867 7:156309137-156309159 AGCTGCTGCTGGGCCAGAGACGG + Intergenic
1035728798 8:1840858-1840880 GGGTGCTGCTGGGGTGGAGAGGG + Intronic
1036518915 8:9472323-9472345 AGGTGCTCCAGTGGAGGAGATGG - Intergenic
1037501758 8:19493198-19493220 AGCTGTTGCTGTGAAATAGAAGG - Intronic
1037755791 8:21709429-21709451 AGGAGCAGCTGTGGAGGATATGG - Intronic
1037916199 8:22774937-22774959 AGGGGCTCCTGGGGAAGAGCTGG - Intronic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038067607 8:23979415-23979437 AGCTGCTTCTGGGGAAGAGCTGG - Intergenic
1038245644 8:25852436-25852458 AGGTTCTGCTGTTGTAGACAGGG - Intronic
1038650929 8:29402530-29402552 CCGAGCTGCTGTGGGAGAGAAGG - Intergenic
1038888626 8:31693613-31693635 AGGTGCTGCTTGGGCAGGGACGG + Intronic
1039041786 8:33415383-33415405 AGAAGCTGCTTTGGAGGAGAAGG + Intronic
1039436642 8:37564105-37564127 AGGTGTGGCTGTGGAGGAAATGG - Intergenic
1039774689 8:40723817-40723839 AGGTGCTGCTGGTGGAGAGGGGG + Intronic
1040631704 8:49220934-49220956 TTTTGCTGCTGTGGAAAAGAGGG + Intergenic
1040709898 8:50175528-50175550 AGCTGTTGCTGTGTAAGAGGGGG + Intronic
1041368304 8:57132335-57132357 ATGAGCAGCTGTGGAAGGGAGGG + Intergenic
1041928606 8:63264153-63264175 AGGAGATGCTGGGGAAGAAAAGG - Intergenic
1042397283 8:68307038-68307060 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1042578431 8:70249236-70249258 AGATGCTGCTGTGGGTTAGAGGG - Intronic
1043585549 8:81765164-81765186 AGATACTGCTATTGAAGAGATGG - Intergenic
1043859347 8:85297935-85297957 TGCTGCTGCTAGGGAAGAGAAGG + Intergenic
1043948019 8:86276001-86276023 AGGGACTGTTGTGGAAGAGGTGG - Intronic
1044355088 8:91213145-91213167 AGGGGGTGCTGTGGGAGAGCAGG + Intronic
1044552330 8:93526037-93526059 AGGTCCTGTTGTGGAAGGGCTGG + Intergenic
1044553683 8:93539128-93539150 GAGTGCTGCTGTGGTGGAGAGGG + Intergenic
1045492041 8:102677346-102677368 AGGTGCTGGAGTGGAAGCGAAGG - Intergenic
1045821528 8:106344102-106344124 ATCTGGTGCTGTGGAAGACAGGG - Intronic
1046031135 8:108785216-108785238 AGGTGCAGCTGTGAAGGAAATGG - Intronic
1047358496 8:124145617-124145639 AGGTGCTGCTGAGGCAGGCAGGG + Intergenic
1047503545 8:125461005-125461027 CTGTGCTACGGTGGAAGAGATGG - Intergenic
1047669175 8:127126037-127126059 ATGTGTTGCTGTAGAAGAGTTGG - Intergenic
1047802264 8:128322378-128322400 AGGGCCTGCTCTGCAAGAGAAGG + Intergenic
1047890429 8:129302918-129302940 TGCTGCTGCTGTGGAAGATGGGG + Intergenic
1047982864 8:130201278-130201300 AGGTACTGCTCTGGAAGATCTGG + Intronic
1048010667 8:130452898-130452920 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1048247661 8:132826300-132826322 AGATGCTGCTGAGGAAATGAAGG + Intronic
1048592425 8:135833244-135833266 GGGTGCTGATGTGGAAGACAAGG - Intergenic
1048688902 8:136936293-136936315 AAGTGATGATGTGGAAGAAAAGG + Intergenic
1049465997 8:142751566-142751588 AAGTGCTGCTGTGGAGGTCAAGG + Intronic
1050363787 9:4855419-4855441 GTGTAGTGCTGTGGAAGAGAGGG + Intronic
1050419944 9:5452668-5452690 AAATGGAGCTGTGGAAGAGAGGG + Intronic
1051879717 9:21827335-21827357 AGCTTCTGCTATGGGAGAGAGGG + Intronic
1052396795 9:27948889-27948911 TGGTGCTGTTGTGGAAGGGGAGG - Exonic
1053250579 9:36571194-36571216 AAGTCCTGCTGTGGATGAAATGG + Intergenic
1053434485 9:38066500-38066522 AGGAGCTGCTTTGGGAGAGGGGG - Intronic
1053606387 9:39664730-39664752 AGTTGCTGCTTAGGAAGACAAGG + Intergenic
1053864310 9:42421348-42421370 AGTTGCTGCTTAGGAAGACAAGG + Intergenic
1054247154 9:62677693-62677715 AGGTGCTGCTTAGGAAGACAAGG - Intergenic
1054561272 9:66712225-66712247 AGGTGCTGCTTAGGAAGACAAGG - Intergenic
1054855850 9:69898776-69898798 AGGTAGTGCTGTGGGACAGATGG - Intronic
1055189817 9:73504340-73504362 GGGTGCTGCTGCTGAGGAGATGG - Intergenic
1055720093 9:79163723-79163745 TGGTGCTGTGGTGTAAGAGAGGG - Intergenic
1057395794 9:94678920-94678942 AGGTGCTGCAGCTAAAGAGATGG + Intergenic
1057410258 9:94811517-94811539 GGGGGCAGCTGTGGTAGAGAAGG - Intronic
1057411990 9:94825064-94825086 AACTGCTGCTGCAGAAGAGATGG + Intronic
1058955805 9:109947056-109947078 TGGTGATGGGGTGGAAGAGAAGG + Intronic
1059304747 9:113345134-113345156 AGGTGCTGGTGTAGAAAGGATGG - Intergenic
1060667806 9:125443397-125443419 AGCAGCTGCTGTGGCAGAGCAGG - Intronic
1060734413 9:126057478-126057500 AGGAGCAGCTGTGAAGGAGATGG - Intergenic
1060789927 9:126479060-126479082 AAGAGAAGCTGTGGAAGAGATGG + Intronic
1060875012 9:127077018-127077040 AGCAGCTGCAGTGGAAGGGAGGG + Intronic
1060949912 9:127594930-127594952 AGGTGCTGCTGTCAGGGAGAGGG + Intergenic
1061516270 9:131092331-131092353 GGGAGCTGCTGTGAAACAGAGGG - Exonic
1062303387 9:135888377-135888399 GTGTGCTGCCGTGGAAGAGCTGG - Intronic
1186056556 X:5655278-5655300 AGGTGCTGCAGTCGAGGAAATGG + Intergenic
1186649877 X:11547777-11547799 AGGAACTGCTGTGGAACAAAAGG + Intronic
1186732921 X:12429487-12429509 AGGTGCTTTGGTGGAAGAGGTGG - Intronic
1187479212 X:19639648-19639670 AGGTGCTTCTTAGGAAGAGGTGG + Intronic
1189733663 X:44047956-44047978 ATTTGCTGCTGGGGAAGAGAAGG - Intergenic
1190984472 X:55488654-55488676 AGGAGCTGCTGTGACAGCGAAGG + Exonic
1191689159 X:63922041-63922063 TGGTTCAGCTGTGGGAGAGAAGG + Intergenic
1192221973 X:69203534-69203556 AGGGGCTGGTGGGGAAGTGAGGG - Intergenic
1194085091 X:89516479-89516501 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1194158407 X:90421731-90421753 AGGGACTACTGCGGAAGAGAAGG - Intergenic
1194886943 X:99327756-99327778 AGGTACTGTTGTGGAAGAGGTGG + Intergenic
1195672911 X:107484253-107484275 CAGTGCTGCTGGGGAAGAAAGGG + Intergenic
1196473737 X:116058745-116058767 ATGTGCTGGTGGGGAAGGGAAGG + Intergenic
1197082005 X:122429647-122429669 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1197704481 X:129623821-129623843 AGGTGAGGCTGGGGAAGTGATGG + Intergenic
1197874685 X:131090273-131090295 AGGGGCTGATGTGGAATAAATGG + Intergenic
1198674433 X:139117229-139117251 AGGTGCTGCTGGTGTAGAGTTGG + Intronic
1199788709 X:151129735-151129757 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1200238970 X:154483784-154483806 AGATGCTGCTCTGGCAGTGAGGG + Exonic
1200276143 X:154734703-154734725 AGGGGCTGCTTTGCAAGGGAAGG + Intronic
1200437739 Y:3172363-3172385 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1200504726 Y:3998698-3998720 AGGGACTACTGCGGAAGAGATGG - Intergenic
1201608093 Y:15810008-15810030 AGGTGATTCTTGGGAAGAGAAGG + Intergenic