ID: 1171467678

View in Genome Browser
Species Human (GRCh38)
Location 20:25342522-25342544
Sequence CTGTTGGAATGTTGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171467678_1171467681 1 Left 1171467678 20:25342522-25342544 CCATTTTTCCAACATTCCAACAG 0: 1
1: 0
2: 2
3: 13
4: 237
Right 1171467681 20:25342546-25342568 ATGTGCTCACTTTGTATCTTTGG 0: 1
1: 0
2: 8
3: 27
4: 280
1171467678_1171467683 19 Left 1171467678 20:25342522-25342544 CCATTTTTCCAACATTCCAACAG 0: 1
1: 0
2: 2
3: 13
4: 237
Right 1171467683 20:25342564-25342586 TTTGGGTCAGTATTTTTTACCGG No data
1171467678_1171467682 2 Left 1171467678 20:25342522-25342544 CCATTTTTCCAACATTCCAACAG 0: 1
1: 0
2: 2
3: 13
4: 237
Right 1171467682 20:25342547-25342569 TGTGCTCACTTTGTATCTTTGGG 0: 1
1: 0
2: 6
3: 35
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171467678 Original CRISPR CTGTTGGAATGTTGGAAAAA TGG (reversed) Intronic
902794309 1:18791132-18791154 CTGAAGGAAGGTTGGAGAAATGG - Intergenic
907791555 1:57670607-57670629 CTGTTGGAAAGATGAAGAAAAGG + Intronic
907849422 1:58240143-58240165 TTTTTGGAATGTGGGAAGAATGG - Intronic
908923768 1:69228339-69228361 CTGTTGATTTGTGGGAAAAAGGG - Intergenic
908931890 1:69326736-69326758 CTGTTGGCAAGTTCTAAAAATGG + Intergenic
910382546 1:86644392-86644414 CTGTGGGAGTGTTAGAAAAATGG - Intergenic
910523421 1:88149979-88150001 CAGTTGGAAGGTTGGCAACAAGG - Intergenic
911677514 1:100676163-100676185 CTCCTGGAATTTTGGAAGAAAGG - Intergenic
912251228 1:108014502-108014524 CTATTGGAATATTTGAAACATGG + Intergenic
913533457 1:119749489-119749511 CTGTGTGCATGTTGGAAATACGG - Intronic
914224822 1:145711781-145711803 CTCTTGGAGTGTTGGTTAAAAGG + Intergenic
916122567 1:161541724-161541746 CTGTTACAATGTTGGACAAAGGG + Intergenic
916132466 1:161623161-161623183 CTGTTACAATGTTGGACAAAGGG + Intronic
916628311 1:166583746-166583768 CTGTAGCAATGTGGGAAAAGAGG - Intergenic
919058692 1:192603488-192603510 ATGTTTGACTGTTGGAAGAAAGG - Intergenic
919390794 1:196982946-196982968 CTGTAGGAACTTGGGAAAAAGGG - Exonic
919974458 1:202601808-202601830 CTCTTGGCATGATGGAAACAGGG - Intronic
920264963 1:204714985-204715007 CTGTTGGGAGGTGGGAAAGAGGG - Intergenic
920657885 1:207889733-207889755 CTGTTGGAATTTTAGAAACAAGG - Intronic
921713101 1:218392505-218392527 CTCTTGTACTGTTGGAACAATGG + Intronic
922778550 1:228230319-228230341 CTTTTCAAATTTTGGAAAAAAGG + Intronic
923632631 1:235662599-235662621 CTTTTGGAATCATAGAAAAAGGG + Exonic
923838550 1:237642295-237642317 ATGTTAGAATGTTAGAAAACTGG + Intronic
924437825 1:244059289-244059311 TTATTGAAAGGTTGGAAAAAGGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1064929228 10:20605107-20605129 AAGTTGGGAAGTTGGAAAAATGG - Intergenic
1064956787 10:20920154-20920176 CTGTTGGACTGTGGAAAAACAGG + Intronic
1065468536 10:26052239-26052261 TTGTAGCAATGTTGGAAAGAAGG - Intronic
1068427819 10:56890432-56890454 CTGATGGAATGTTGGCTAATAGG - Intergenic
1069352199 10:67541982-67542004 ATGTTGGAATGTTGAACAACTGG + Intronic
1069597982 10:69684973-69684995 CTGGGGGAATGCTGGAAACAAGG + Exonic
1070239352 10:74662615-74662637 CTGTTGGAAAGTTTTAAATAAGG - Intronic
1072021187 10:91403814-91403836 CTGTTAGAATGCTGGACAACAGG + Intergenic
1072326932 10:94307925-94307947 GTGTTGGAGAGATGGAAAAATGG - Intronic
1072866003 10:99062404-99062426 CTGGAAGAATGTTGGAAGAATGG - Intronic
1072955331 10:99883165-99883187 CTTTTTGGATTTTGGAAAAAGGG + Intronic
1075184765 10:120245782-120245804 CTGCTGGAATGTGGGAAGCAGGG - Intergenic
1075813508 10:125246295-125246317 GTGTTGGAAGGAAGGAAAAATGG + Intergenic
1078058049 11:8023341-8023363 ATTTTGGTAGGTTGGAAAAATGG - Intronic
1079097852 11:17522552-17522574 TTCTTGGAATGTTGGAAGACAGG + Intronic
1079508511 11:21182831-21182853 CTCTTCAAATGTTGGGAAAACGG + Intronic
1084523343 11:69679527-69679549 CACTTGGAATATAGGAAAAAGGG + Intergenic
1085137640 11:74107538-74107560 CTGTTATAATGTTTGATAAAAGG + Intronic
1086992501 11:93319453-93319475 CTGTTCAAATAGTGGAAAAATGG - Intergenic
1087520195 11:99223611-99223633 TTGTTGGAATGATGCAAACAGGG - Intronic
1087548202 11:99611736-99611758 CTATTAGAATGACGGAAAAAAGG - Intronic
1090183414 11:124720117-124720139 CTGCTGGAAGGTTGGAATAGAGG + Intergenic
1090593167 11:128293617-128293639 CTGATGGAATGCTGCAAGAAGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092191973 12:6527879-6527901 CTGTTGGATGGTAAGAAAAATGG + Exonic
1093089998 12:14910436-14910458 GTGTTGAACTTTTGGAAAAAAGG - Intergenic
1094245256 12:28284149-28284171 CCATTGGAGTATTGGAAAAAAGG + Intronic
1094456110 12:30635172-30635194 ATATGGGAATGTTGGTAAAAGGG + Intronic
1097047523 12:56198388-56198410 CTGGTGGAATGTGGGAAGGAAGG - Intergenic
1097097796 12:56563553-56563575 AATTAGGAATGTTGGAAAAATGG + Intronic
1097754400 12:63393008-63393030 CTGTTGGCATATTCGAAAACAGG + Intergenic
1097842563 12:64336167-64336189 CTGTTGGCATAATGGAAAAGGGG + Intronic
1098863311 12:75733620-75733642 CTGTTGGAAAGTAGGGGAAACGG + Intergenic
1100552029 12:95654807-95654829 ATGTTGGAATGTTGGGATGATGG + Intergenic
1100912669 12:99383237-99383259 CTGTGAGAATTTTGAAAAAAAGG + Intronic
1101590297 12:106119542-106119564 CTGTAGGGAAGCTGGAAAAATGG + Intronic
1102704557 12:114869848-114869870 CTTATTGAATGTTGGAAACAGGG - Intergenic
1104223429 12:126808436-126808458 CTTATGTAATGATGGAAAAATGG - Intergenic
1109989813 13:70040029-70040051 CTGGTGAAATGTTGGCATAAGGG - Intronic
1110136390 13:72072378-72072400 CTTATGGAATAATGGAAAAATGG + Intergenic
1110186755 13:72683800-72683822 CTGTTGGAAATTAGGAAGAAGGG - Intergenic
1110403509 13:75121954-75121976 GTTTTGCAATGTTGCAAAAAAGG - Intergenic
1111043833 13:82788862-82788884 TTCTTGGAAAGTAGGAAAAAGGG + Intergenic
1111635477 13:90898043-90898065 CTGTTTGAATTTAGGACAAAAGG + Intergenic
1112628150 13:101129577-101129599 TTATTGGAAAATTGGAAAAATGG + Intronic
1112664043 13:101548123-101548145 CTGTTAGAATGTAGAAAAGAAGG + Intronic
1114918414 14:27296053-27296075 ATGTTGAAATGTTGGAAAAGGGG - Intergenic
1115309687 14:31966685-31966707 CTGTGGAAATCTTGGAAACAGGG + Intergenic
1116808640 14:49518274-49518296 CTTTTGGAAAGTTGGAAAGTTGG - Intergenic
1119184881 14:72633070-72633092 TTGTTTGAATGTTGGGAATATGG + Intronic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1120096535 14:80395098-80395120 GTGTTGGCTTATTGGAAAAATGG + Intergenic
1120605060 14:86564589-86564611 CCCTTGGAATTTTGGAAATATGG + Intergenic
1121050920 14:90818400-90818422 CTCTTGGAAAGTTGGAGTAAGGG - Intergenic
1124270970 15:28280339-28280361 TTGTTGCAATGTTGAGAAAATGG + Intronic
1126095977 15:45091028-45091050 GGGCTGGAAAGTTGGAAAAAGGG + Intergenic
1128640970 15:69337054-69337076 CTATTGGAATAGAGGAAAAAAGG + Intronic
1129563816 15:76599304-76599326 TTGTTGGAAAGTAGGTAAAATGG + Intronic
1130056988 15:80534877-80534899 CAGTAGGAGTGTGGGAAAAAAGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130090386 15:80815980-80816002 CTGGAGGAATATTGGAAAGAGGG - Intronic
1131006801 15:88985026-88985048 CATTTGGAATGTTGGAATGATGG + Intergenic
1133959792 16:10483498-10483520 CTGTTTGAAAGTTCGAAAGAGGG + Exonic
1138401674 16:56750215-56750237 AAGTTGGAATGTTGAAAGAATGG + Intronic
1138851527 16:60635257-60635279 CAGATGGAATCTTGGAACAACGG - Intergenic
1139708144 16:68756244-68756266 ATGTGGGAGTGTTTGAAAAAGGG + Intronic
1140907834 16:79424688-79424710 CTGTGAGACTGTTGGAAAGATGG + Intergenic
1142563673 17:826036-826058 GTGATGGAATGTTGGAAATTCGG + Exonic
1144133953 17:12274960-12274982 CTGTTGAAATGTTGTAAGTAAGG + Intergenic
1144244828 17:13352564-13352586 CTGCGGGAATGTTGGAGAATGGG - Intergenic
1144328409 17:14203787-14203809 CTGTGGGAATGTTCAGAAAAAGG - Intronic
1144457559 17:15431541-15431563 CTGTTGGCATGCTGCAAACATGG + Intergenic
1148197327 17:45723518-45723540 ATGGTGGAATGGTGGAAGAAGGG + Intergenic
1149423693 17:56534573-56534595 CTGTTAAAATGTTGGAAAGGAGG - Intergenic
1150018264 17:61582268-61582290 GTCCTGGAATGTTAGAAAAATGG - Intergenic
1150053060 17:61984214-61984236 GAGTTGGACTGTTGGAAAATTGG - Exonic
1150364659 17:64571269-64571291 GTCTTGGAATGTTAGGAAAAGGG - Intronic
1150382279 17:64730223-64730245 ATGTTGGAAAGATGGACAAATGG - Intergenic
1150773993 17:68064621-68064643 ATGTTGGAAAGATGGACAAATGG + Intergenic
1153315286 18:3715232-3715254 CTGTTGGAATGGGTGAGAAATGG + Intronic
1153588866 18:6652225-6652247 CTGTAGGAGTGTGGGAACAAGGG + Intergenic
1155960563 18:31991424-31991446 CTGTTAAAAAGTTGGAAAATAGG - Intergenic
1156805246 18:41170875-41170897 CTGTTAGAATTTTCAAAAAAAGG - Intergenic
1156878520 18:42046153-42046175 CATGTGAAATGTTGGAAAAAAGG - Intronic
1159461758 18:68730494-68730516 CTGTTGAAATTATGAAAAAATGG - Intronic
1159605895 18:70474537-70474559 CTGATTGAATGTGGGAAGAAGGG + Intergenic
1159711832 18:71769888-71769910 CTTTTGGAAATTTGGCAAAATGG - Intronic
1159733722 18:72065780-72065802 TAGTTGTAATTTTGGAAAAAAGG - Intergenic
1159901451 18:74051132-74051154 ATGTTGGAATCTTAGAGAAATGG - Intergenic
1160430356 18:78806997-78807019 TTGATGGAATGTGGGTAAAATGG + Intergenic
1163291889 19:16384373-16384395 CTGCTGGAAAGTTGGAAATGGGG - Intronic
1164852795 19:31498925-31498947 CTGTTGGACCGTGGGAAGAATGG - Intergenic
1165182237 19:33981457-33981479 CTGCTGGAGTGTTGTCAAAAGGG + Intergenic
1165469731 19:35996268-35996290 CTCTCGGAATGTTGGACAAAGGG + Exonic
1166728774 19:45045748-45045770 TTGTTGGAGTGTTGGACACATGG + Intronic
1168446865 19:56425859-56425881 TGGTTTGAATGTTGGAGAAAGGG - Exonic
927318011 2:21708313-21708335 ATGTTATAATGTTGGAAGAAAGG - Intergenic
927332341 2:21880294-21880316 TTGTGGGAATGTAGGAAATATGG - Intergenic
928362160 2:30673092-30673114 TTGTTGGACTGTTTGAAACAAGG + Intergenic
930970463 2:57388938-57388960 CTGTGAGAATGTGGAAAAAATGG + Intergenic
931063760 2:58561272-58561294 AGGTTGGAATATGGGAAAAATGG + Intergenic
931323177 2:61192524-61192546 GTTTTGGAATGGTGGAAAAGAGG + Intronic
933347635 2:81109471-81109493 TGGTAGGAATGTGGGAAAAATGG - Intergenic
935201192 2:100857949-100857971 CTGTAGGCAAGTTGGAAAACTGG + Intronic
935279984 2:101508591-101508613 CTGTTGGATTGATGGAAGCATGG + Intergenic
936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG + Intronic
937593445 2:123643815-123643837 GTGTTGGTGTGATGGAAAAAAGG - Intergenic
939248841 2:139660859-139660881 CTGCTTGAGTGCTGGAAAAATGG - Intergenic
939359796 2:141155958-141155980 CTGTAGGAATTATGGAAGAAAGG - Intronic
939748831 2:146015140-146015162 ATGTTGGAATGTGGGTAAGAGGG + Intergenic
941079311 2:161041677-161041699 CAAATGGAGTGTTGGAAAAAAGG - Intergenic
942849816 2:180471370-180471392 CTGTTAGAAAGATGGAAAAGGGG - Intergenic
943281209 2:185935570-185935592 CTGTTGGAGATGTGGAAAAAGGG - Intergenic
945053921 2:205851258-205851280 CTCATGGAATGTTGGGAGAATGG - Intergenic
945858779 2:215096919-215096941 CTAATGGAATTTAGGAAAAAGGG + Intronic
946392934 2:219427112-219427134 CTGTTGGCATCTTTGAAGAAGGG - Intergenic
947350674 2:229241420-229241442 CTGTTGGACTGAGGGCAAAATGG - Intronic
947350949 2:229244457-229244479 GAGTTGGAATTTTGGAAAATAGG - Intronic
947965647 2:234279470-234279492 CTCTAGGAATGTTGTATAAAGGG - Intergenic
1169969210 20:11250664-11250686 ATGTTGGTATATTTGAAAAAGGG - Intergenic
1170221300 20:13944850-13944872 GTGTTGGAATTTTGGTAAGAAGG + Intronic
1171308093 20:24123225-24123247 CTGCTGGAGTGTAGGCAAAAAGG + Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1173144611 20:40513853-40513875 TGGGTGCAATGTTGGAAAAATGG + Intergenic
1176956530 21:15110566-15110588 CTGTTTGCATGTGGGAAAATGGG + Intergenic
1180588641 22:16916426-16916448 CTTTTCCAATCTTGGAAAAAAGG - Intergenic
1181956034 22:26588921-26588943 CTGTTGGGAAGTGAGAAAAAGGG + Intronic
1182010195 22:26994459-26994481 CTCATGGAATGATGGCAAAATGG + Intergenic
950273550 3:11639403-11639425 CTGTTGTGATGTTGGGGAAAGGG - Intronic
950380485 3:12610273-12610295 CTGTTGGATAGTGAGAAAAATGG - Intronic
950938462 3:16867626-16867648 GTGTTCTAATGTTGGCAAAATGG + Intronic
951083520 3:18481793-18481815 CTATTTTCATGTTGGAAAAATGG - Intergenic
953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG + Intronic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955833839 3:63031997-63032019 CTCTTGGAATGTTCCAAACAGGG + Intergenic
956173318 3:66450314-66450336 CTGTGGGAGTGTTTGACAAATGG - Intronic
956247384 3:67198916-67198938 CCATTGGAATTTTGGAGAAATGG - Intergenic
956755426 3:72381209-72381231 CTGTTAGAATCTGTGAAAAAGGG - Intronic
956887274 3:73572882-73572904 TTGTTGGAATTTTGAAAAGATGG + Intronic
959010994 3:101076189-101076211 CTGTTGGAAAGTAGAAAAGAAGG - Intergenic
961721723 3:128901477-128901499 CTGTTGGGAAATTGGCAAAATGG + Intronic
963065699 3:141262015-141262037 CAGTTTGAATGATGGAAAGAAGG + Intronic
970451616 4:16172506-16172528 CTCCTAGAATTTTGGAAAAATGG - Intronic
971188876 4:24407695-24407717 CTGTTTGAATGTTGGACATAGGG + Intergenic
971595916 4:28528383-28528405 CTGTTATAATTTTGGAAATAAGG + Intergenic
971667861 4:29514748-29514770 CAGTTGGAATGTGGTTAAAAAGG - Intergenic
972244482 4:37230172-37230194 CTGATAGATTGTTGGAAAGAAGG + Intergenic
972250091 4:37290654-37290676 AAGATGGCATGTTGGAAAAATGG + Intronic
974715383 4:65662821-65662843 TTGTTGGAAGGCTGGAAGAAAGG - Intronic
974735465 4:65925744-65925766 CTGTTGGAATGCTGGAGACAAGG - Intergenic
975131660 4:70838403-70838425 CTTATGGAATTATGGAAAAATGG - Intronic
975696111 4:77014816-77014838 ATGTTGGAATTGTGTAAAAATGG + Intronic
975724118 4:77275635-77275657 CACTTGGAATGATGGAAAAAGGG + Intronic
975819699 4:78257635-78257657 CTTTTTGAATGGTGGAAATATGG - Intronic
975827917 4:78339127-78339149 GTCTTGGAAAGTGGGAAAAATGG + Intronic
975944560 4:79689770-79689792 CTGTTGAAATTTTAAAAAAATGG - Intergenic
976721513 4:88173265-88173287 CTGTGGGAAAGAGGGAAAAAAGG - Intronic
977173987 4:93797072-93797094 CTGATTGAATGTTGACAAAATGG + Intergenic
977692726 4:99933699-99933721 TTGTGGGAATTCTGGAAAAAAGG + Intronic
978641813 4:110879575-110879597 CTGTTGGAAAGATGTAACAAAGG - Intergenic
979008127 4:115330664-115330686 CTGTTTTACTGTTGGGAAAATGG + Intergenic
979384671 4:120050386-120050408 CTATGTGAATGATGGAAAAAAGG - Intergenic
980880673 4:138707208-138707230 CTGGTGTAATGCTGGGAAAAGGG - Intergenic
983353240 4:166621466-166621488 ATGTCGGAATGTGGGAATAAAGG + Intergenic
983642156 4:169953174-169953196 TTGATGGAATGGTGGAGAAATGG + Intergenic
985104936 4:186490857-186490879 CTGTAGGATGGTTGGACAAAGGG + Intronic
986016326 5:3760768-3760790 CTATTGGAATATTGGAATTAAGG - Intergenic
986626766 5:9729956-9729978 CTGGTGGAATGGTAGATAAAGGG + Intergenic
988862228 5:35294414-35294436 CAGTTTGAATATTGTAAAAACGG - Intergenic
990259781 5:54009834-54009856 CTGTTGGAATATTGCTAAAATGG - Intronic
990493060 5:56320852-56320874 CTGTTAGAAAGTAGGAGAAACGG + Intergenic
992146788 5:73858697-73858719 CAGTTGGAATGCTGTAGAAATGG - Intronic
992921103 5:81521752-81521774 TTGTTGTAATGTTGGAAAGTTGG + Intronic
993314889 5:86389951-86389973 CTTTTGGAAGTTTGAAAAAACGG - Intergenic
994115017 5:96051946-96051968 GTTTTGGAATGTTAAAAAAATGG - Intergenic
995787643 5:115847240-115847262 CTGTTGGAAAGATGAAAGAAAGG + Intronic
996057477 5:118997749-118997771 CCTTTGGAATATTGGAATAAAGG - Intergenic
997281846 5:132653931-132653953 CTGCTGGAATGCTGGAGACAGGG + Intergenic
1000036174 5:157449759-157449781 CTGTTGGAATTTTGCATAAAAGG - Intronic
1003745244 6:8993811-8993833 CATTTGGAATGTTAGACAAATGG - Intergenic
1003823715 6:9928812-9928834 CAGTAGGAATGGTGGAATAATGG - Intronic
1008097853 6:47358307-47358329 CTGTTTTAATCTTGGAAATAAGG + Intergenic
1008412356 6:51194411-51194433 CTGCTGGAATTTTGAAAAAAAGG + Intergenic
1009508697 6:64519859-64519881 CTGTTGGAATTTTTATAAAAGGG + Intronic
1009905878 6:69868752-69868774 CTGTTGGTATTTTCCAAAAATGG + Intronic
1010681616 6:78806067-78806089 AGGTTGAAATGATGGAAAAAGGG - Intergenic
1010914127 6:81594890-81594912 CTGATGGAATTTTGAAATAAGGG - Intronic
1012850874 6:104445517-104445539 TTTTTAGAATGTTGCAAAAATGG - Intergenic
1013060218 6:106626290-106626312 ATGTTGTAATGTTGGTATAATGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015047902 6:128799999-128800021 CTGTATGAATTTTGGTAAAATGG - Intergenic
1015084143 6:129266951-129266973 CTGTTGCAATGTTTCAATAATGG + Intronic
1017489807 6:154935020-154935042 TTGTTGGAATGTAGGAAAAAGGG + Intronic
1021232478 7:18102850-18102872 TTGCTGGAATGTGGGAATAATGG + Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023675517 7:42625418-42625440 CTGTTCTAATGTTAGAAACATGG - Intergenic
1025601324 7:63000537-63000559 TTGTTCGAAAGATGGAAAAAAGG - Intergenic
1029902869 7:104060494-104060516 ATGTTGAAATGAAGGAAAAAAGG + Intergenic
1029955972 7:104640270-104640292 CTGTTGGAGGGTTGGGAGAAAGG - Intronic
1032282012 7:130511470-130511492 CTGTGGGAATGCTGTACAAATGG + Intronic
1035012418 7:155731216-155731238 CTGATGGAAGGTAGGAAAGAAGG + Intronic
1038609401 8:29046260-29046282 CTTTTGGCATGTTTGAAACAGGG - Intronic
1042496696 8:69463035-69463057 TTATTTGCATGTTGGAAAAATGG + Intergenic
1042617606 8:70667739-70667761 CTGTTTCAACGCTGGAAAAAAGG + Intronic
1043091420 8:75909082-75909104 CTATTGAAATGTATGAAAAATGG + Intergenic
1046689845 8:117270410-117270432 TTGTTGGAATGTTGCTTAAAAGG + Intergenic
1046856508 8:119038421-119038443 TTATTGTAATTTTGGAAAAAGGG + Intronic
1047119471 8:121884678-121884700 CTCTTAGAATGTTGAAACAAAGG + Intergenic
1047705450 8:127494814-127494836 CTGTTTCCATTTTGGAAAAAGGG - Intergenic
1047739838 8:127797539-127797561 CTTTTGGAATGCTGCCAAAATGG + Intergenic
1048553714 8:135456542-135456564 CTGTTTGAAGGCAGGAAAAATGG + Intergenic
1048649357 8:136457251-136457273 CTGTTAGAATCTTGGATACATGG - Intergenic
1050573176 9:6963929-6963951 GTATTTGAATGTTTGAAAAATGG + Intronic
1052174726 9:25444172-25444194 CTGTTGGTATGTTGTAAAAAAGG + Intergenic
1056247902 9:84716241-84716263 AAGTTGGAAGGTTGGAAAAGTGG - Intronic
1057270543 9:93648170-93648192 CTGTTGGTTTGTTGGAGAGAAGG + Intronic
1057846371 9:98529228-98529250 TTGTTGGAATATAGGAAGAAAGG + Intronic
1059781686 9:117535433-117535455 CTGTTGAAATGTTGGAAGATAGG - Intergenic
1060856295 9:126916476-126916498 CTCTTGGAATGTGGTAAAATCGG - Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1185913854 X:4012598-4012620 CTCTTGGGATGTGGGTAAAAAGG + Intergenic
1189643710 X:43103257-43103279 ATGTTGGACTATAGGAAAAATGG - Intergenic
1191112694 X:56819877-56819899 ATGTTAGAATGTGGGAAAACAGG + Intergenic
1192405898 X:70885983-70886005 CTGTTGGTAGGATGGTAAAATGG + Intronic
1193978683 X:88155469-88155491 CTATTAAACTGTTGGAAAAATGG - Intergenic
1197967432 X:132080225-132080247 CTTTTGGAATATGGGAGAAAAGG - Exonic
1201772303 Y:17626869-17626891 CTGTTGGGTTTTTAGAAAAAAGG + Intergenic
1201829252 Y:18279117-18279139 CTGTTGGGTTTTTAGAAAAAAGG - Intergenic