ID: 1171473572

View in Genome Browser
Species Human (GRCh38)
Location 20:25390662-25390684
Sequence GCGCTCATGCTCCAAGGCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171473570_1171473572 -10 Left 1171473570 20:25390649-25390671 CCGCGGCGGCGCAGCGCTCATGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1171473569_1171473572 -9 Left 1171473569 20:25390648-25390670 CCCGCGGCGGCGCAGCGCTCATG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1171473560_1171473572 26 Left 1171473560 20:25390613-25390635 CCAGCGCCGCGGCGGCCGAGCCG 0: 1
1: 0
2: 6
3: 45
4: 333
Right 1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1171473563_1171473572 20 Left 1171473563 20:25390619-25390641 CCGCGGCGGCCGAGCCGGAGGAG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1171473565_1171473572 11 Left 1171473565 20:25390628-25390650 CCGAGCCGGAGGAGGACGAGCCC 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1171473567_1171473572 6 Left 1171473567 20:25390633-25390655 CCGGAGGAGGACGAGCCCGCGGC 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171473572 Original CRISPR GCGCTCATGCTCCAAGGCGA CGG Exonic