ID: 1171477082

View in Genome Browser
Species Human (GRCh38)
Location 20:25419170-25419192
Sequence GTCCATGTGGAGCACAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171477079_1171477082 1 Left 1171477079 20:25419146-25419168 CCTATCACAGGGTTACTTCAGGT 0: 1
1: 0
2: 2
3: 10
4: 83
Right 1171477082 20:25419170-25419192 GTCCATGTGGAGCACAGCATAGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171477082 Original CRISPR GTCCATGTGGAGCACAGCAT AGG Intronic
900999824 1:6143367-6143389 GTCCATTGGGAGGACTGCATGGG - Intronic
901664328 1:10817840-10817862 TTCCCCGTAGAGCACAGCATTGG + Intergenic
903172938 1:21564807-21564829 ATCCCTGTGGAGCTCAGCACAGG + Intronic
904043009 1:27594845-27594867 GTGCAGGCGGAGCACAGAATGGG + Intronic
904700220 1:32353562-32353584 GTCCTTGTCCAGCTCAGCATGGG + Intronic
904843341 1:33388704-33388726 CACCATGTGCAGCACAGAATGGG + Intronic
905352963 1:37360185-37360207 GGCCCTTTGGAGTACAGCATTGG + Intergenic
906718604 1:47988888-47988910 ATACATTTGGACCACAGCATAGG - Intronic
906781149 1:48574209-48574231 GTCCAGGTGGAACAGTGCATAGG - Intronic
907700755 1:56785763-56785785 GCACATTTGCAGCACAGCATGGG - Intronic
907830095 1:58056681-58056703 ATCCATGTGGACTACACCATGGG + Intronic
908254894 1:62295087-62295109 GGGCATTTGGAGCATAGCATAGG + Intronic
909601905 1:77469687-77469709 GACCATATGGAGCACAGTTTGGG - Intronic
914955084 1:152154906-152154928 GTCCATGTGGGACACAGGACAGG - Exonic
915589819 1:156864447-156864469 GTGGGTGTGGAGCTCAGCATGGG + Intronic
915726215 1:158019545-158019567 GTCAGTGTGGAGCTCAGCCTGGG - Intronic
915974984 1:160379516-160379538 GTCCAGGTGAAGAAAAGCATTGG - Intergenic
919628558 1:199936712-199936734 GGCCATGGGGTGCATAGCATGGG - Intergenic
921945318 1:220882167-220882189 GTCCTTCGTGAGCACAGCATAGG - Exonic
922731190 1:227949476-227949498 GTGCATGTGGGGCAAAGCAAGGG + Intergenic
924461266 1:244260586-244260608 ATTCTTGTGGAACACAGCATAGG + Intergenic
1067078443 10:43201037-43201059 GACAAAGTGGGGCACAGCATGGG + Intronic
1067278381 10:44853639-44853661 CTCCAGCTGGAGGACAGCATGGG + Intergenic
1068492136 10:57737628-57737650 GTCCAGATGGAGCATAGCAGTGG + Intergenic
1073129555 10:101178433-101178455 TGACATGTGGAACACAGCATTGG + Intergenic
1075413258 10:122244502-122244524 GTCCTTGTGGAAGACAGCAGGGG + Intronic
1076574661 10:131455993-131456015 GCCCTAGTGGAACACAGCATCGG - Intergenic
1078486206 11:11725692-11725714 GTCCATGGGGAGCACACCAGAGG - Intergenic
1079408129 11:20162932-20162954 GTCCACGTGGATCGCAGCAAGGG - Intergenic
1080212664 11:29805044-29805066 ATCCCTGTGAAGCCCAGCATGGG - Intergenic
1080922829 11:36726027-36726049 GTCCATCATGAGAACAGCATGGG + Intergenic
1081890065 11:46533879-46533901 GTGCAGCTGGAGCACAGCAAGGG - Intronic
1083646431 11:64173950-64173972 GACCATGTGGAGCAGAGCCAAGG - Intergenic
1084441255 11:69174839-69174861 CTCCATTTGGTGCACTGCATTGG + Intergenic
1084980795 11:72827497-72827519 GTCCAGGCGGAGTCCAGCATTGG - Intronic
1091494291 12:958701-958723 TTCCACGTGAAGCACACCATAGG - Intronic
1093655324 12:21687823-21687845 GCCCATTTGCAGCACAGCCTTGG + Intronic
1101398107 12:104365830-104365852 GTCCAGGTGGAGCACCTAATAGG - Intergenic
1101490194 12:105203110-105203132 GTCCATCCGGAGCACAGCATGGG - Intronic
1101630523 12:106489090-106489112 GGTCCTGTGGATCACAGCATCGG + Intronic
1106194675 13:27483140-27483162 CACTATCTGGAGCACAGCATGGG - Intergenic
1107090706 13:36476191-36476213 GTCACAGTGGAGCACAACATTGG - Intergenic
1108239922 13:48453489-48453511 GTCCATTTGGAGTGAAGCATAGG + Intronic
1111106111 13:83647695-83647717 AACCATAGGGAGCACAGCATGGG - Intergenic
1111147033 13:84195871-84195893 GGCCATATGGAGTACAGTATGGG + Intergenic
1114904084 14:27102851-27102873 TGCCATGGGGAGCTCAGCATTGG + Intergenic
1117189861 14:53278904-53278926 CTCCCTGTGGACCTCAGCATGGG - Intergenic
1117599309 14:57357870-57357892 GTACATGCTGGGCACAGCATGGG + Intergenic
1118051129 14:62029302-62029324 GTCCCTTTGGAGCACAGTCTTGG + Intronic
1118361676 14:65062416-65062438 CTCAATGTGCAGCACAGCAGAGG - Exonic
1119094408 14:71815561-71815583 GTCTATCTGCAGCACAGCGTAGG + Intergenic
1121618826 14:95332215-95332237 GTGCATGTGCAGGACAGCGTGGG + Intergenic
1122298593 14:100719233-100719255 GTCCAGTTGGAGCCCAGCAGGGG - Intergenic
1125582131 15:40793619-40793641 GTCCAGGTGGAGGGCAGCCTTGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132568910 16:635589-635611 GTCTGTGGGGAGCCCAGCATGGG - Intronic
1132872031 16:2119611-2119633 GTCCATGTGGCACTCGGCATAGG - Intronic
1133168594 16:3966025-3966047 GTCCAGGTGGATGGCAGCATCGG - Exonic
1133580794 16:7142522-7142544 GGCCATGCGGAGAACAGTATAGG - Intronic
1134678823 16:16109652-16109674 TTCCCTGTGGAGCCCAGCATGGG - Intronic
1138187481 16:54987492-54987514 GGCCATGCGGAGTCCAGCATAGG - Intergenic
1143445013 17:7003095-7003117 GTTCGTGTGGAGCAGAGGATGGG - Intronic
1149883665 17:60318386-60318408 TTCCATCTAGAGAACAGCATGGG + Intronic
1151141137 17:71993231-71993253 GCCCATTTGCAGCACAGCCTCGG + Intergenic
1151923846 17:77178873-77178895 GTCCAGGTGAAGTTCAGCATAGG + Intronic
1153421084 18:4906121-4906143 GTCTACATGGAGCCCAGCATTGG - Intergenic
1156491686 18:37500122-37500144 TTCCATTTGGTGCACAGCCTTGG - Intronic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1164857427 19:31535899-31535921 ATCCCTGTGGAGCACAGACTGGG - Intergenic
925292779 2:2758850-2758872 GTCCAGGTGAAGCCCAGCACTGG + Intergenic
926134510 2:10326909-10326931 GGGCATGTGGGGCACAGCAGGGG - Intronic
926372849 2:12197866-12197888 CTCCAGGAGGAGCACATCATGGG + Intergenic
929457542 2:42076586-42076608 GTCCATGTGGGGCTCAGCCGGGG - Intergenic
932509868 2:72275535-72275557 GTCTATGTGAAGCATAACATTGG - Intronic
935017716 2:99200078-99200100 GACCCTGTACAGCACAGCATGGG - Intronic
937341291 2:121092472-121092494 ATCCATGTGTAGCAGAACATAGG - Intergenic
937867818 2:126767188-126767210 CCCCATGTGGATCACAGCACTGG - Intergenic
938809989 2:134843994-134844016 GCCCATGTGGAGCAGAGTCTTGG - Intronic
948640522 2:239373090-239373112 GGCCCTGTGGAGCACAGCCCTGG + Intronic
1171141849 20:22750203-22750225 GTCCATAGGGAGCACAGAAGCGG - Intergenic
1171477082 20:25419170-25419192 GTCCATGTGGAGCACAGCATAGG + Intronic
1174317426 20:49713575-49713597 GTCTATGTGGCGCCCGGCATAGG - Exonic
1176423266 21:6532898-6532920 CTCCATCTGGAACACAGCACGGG + Intergenic
1179698759 21:43141214-43141236 CTCCATCTGGAACACAGCACGGG + Intergenic
1179842015 21:44082851-44082873 GCCCACGTGGACCACGGCATTGG - Exonic
1181343845 22:22203078-22203100 ATCCATGTGGATCTCTGCATGGG + Intergenic
1182979734 22:34657576-34657598 GACTATCAGGAGCACAGCATGGG - Intergenic
1183000233 22:34850842-34850864 GTCCACCTGGAGCACAGGCTGGG + Intergenic
1184244069 22:43227077-43227099 GTCCATGTGCAGCCCAGCCGTGG - Intronic
1185207952 22:49550995-49551017 GTCCGTGTGAACCACAGCAAAGG - Intronic
949817244 3:8071328-8071350 GTCTTTGTGGAGGACAGAATTGG - Intergenic
952287886 3:31985499-31985521 GTCCATGTGGAGAAGAAGATGGG - Intronic
953465070 3:43112680-43112702 GTCCATGTGGTACACATCCTGGG + Intergenic
954626822 3:52026379-52026401 TTCCATGAGGAGCAGAGCAAGGG - Intergenic
956538140 3:70303144-70303166 TTCCTTGTGGAGAAGAGCATGGG + Intergenic
957328902 3:78734192-78734214 TTCCATGTGGAAGGCAGCATAGG + Intronic
963528817 3:146447734-146447756 CTCCATGTCCAGCACAGCACCGG + Intronic
966585415 3:181618539-181618561 GTCCCTGTGGAACAAAGCTTGGG - Intergenic
966908324 3:184543673-184543695 GAGAATGTGGAGCAGAGCATCGG - Intronic
969307365 4:6333496-6333518 CTCCATGGGGATCTCAGCATAGG + Intronic
982255175 4:153444461-153444483 CTCCAGGTGGAGCACAGCCGAGG - Intergenic
984137741 4:175962104-175962126 GTCCGGATGGTGCACAGCATGGG - Intronic
987006786 5:13718628-13718650 GTCTAGCTGGAGAACAGCATGGG + Intronic
988682465 5:33497373-33497395 CTGCATGTTGAGTACAGCATGGG - Intergenic
991233194 5:64360968-64360990 CTCCATTTGGAGCAGAGTATAGG - Intronic
993156813 5:84235323-84235345 GTCACTGTGAGGCACAGCATTGG + Intronic
994535993 5:101030107-101030129 GTCAATGTTGAGCACAGTCTTGG - Intergenic
1001546885 5:172575734-172575756 CCCCATTTGCAGCACAGCATGGG + Intergenic
1002297322 5:178238899-178238921 GTCCATGTGACCCACAGGATGGG + Intronic
1006020999 6:31117526-31117548 GTCCCTGTGGAGGAAAGCAGTGG + Exonic
1006580773 6:35076487-35076509 GGCCATGTGGACAGCAGCATTGG + Intronic
1008273554 6:49517464-49517486 ATCCTTGTAGAACACAGCATAGG - Exonic
1017677215 6:156826713-156826735 GTCCTTGCCGAGCACAGCAGTGG + Intronic
1019004211 6:168782706-168782728 GGCCATGTGCAGCTCAGCAGGGG - Intergenic
1021090788 7:16480215-16480237 GTGAATGCTGAGCACAGCATTGG + Intronic
1021456671 7:20836463-20836485 GGCATTGGGGAGCACAGCATTGG - Intergenic
1022379212 7:29843904-29843926 CTAGATGTGGAGCTCAGCATGGG - Intronic
1022514002 7:30964052-30964074 GTCCATGGTGAGCCCAGCAGTGG - Exonic
1022994954 7:35745889-35745911 GTCCAAGTGGAGCATGGCAGAGG - Intergenic
1025036150 7:55593595-55593617 GTGCATGTGTAGCACAGGAAGGG + Intergenic
1026394709 7:69939752-69939774 ATCTATGTAGAGCAGAGCATGGG + Intronic
1026625540 7:71988765-71988787 TTCCATGTAGAGCACTACATGGG + Intronic
1029436199 7:100565315-100565337 GTCCATGAGGAGCACAGCGCTGG - Exonic
1031997716 7:128243512-128243534 GTCAAGATGGAGCACAGCTTAGG + Intronic
1034483389 7:151341190-151341212 GTCACTGTTGAGCACAGCCTTGG + Intergenic
1034868842 7:154664630-154664652 TTCCATATGGAGCACAGCACAGG - Intronic
1035307302 7:157941729-157941751 CTCCATGCAGAGCCCAGCATAGG - Intronic
1035369250 7:158368614-158368636 GTCCCTGTGCAGCAAAGCAGTGG - Intronic
1037889865 8:22618365-22618387 GTCTAAGGGGAGCACAGCAGAGG - Exonic
1041224522 8:55685301-55685323 GTCCATGGGGAGCAGAGCAAAGG - Intergenic
1046198775 8:110894415-110894437 CTCCCTCTGGACCACAGCATAGG - Intergenic
1046717870 8:117586893-117586915 CTCCATATCGAGAACAGCATGGG - Intergenic
1047942238 8:129837101-129837123 TCCCATGTGGGGCACAGCCTGGG + Intergenic
1049047519 8:140164705-140164727 GTCCAGGTGGAACTCCGCATGGG + Intronic
1052475792 9:28957185-28957207 GTGCATGTGAAGCACACCCTGGG + Intergenic
1052530595 9:29679504-29679526 GTCCATGAGGAGGACTGAATTGG + Intergenic
1060553642 9:124497485-124497507 GGGCATTTGGAGCTCAGCATCGG + Intronic
1060781810 9:126418637-126418659 GGCCACGTGGAGCCCAGCATGGG - Intronic
1060908370 9:127328557-127328579 CTCCATGTGTAGTACAGCTTGGG - Intronic
1061218240 9:129234373-129234395 GGCCATGTGGAGCAGAGCAGTGG + Intergenic
1061935049 9:133852884-133852906 GTCTATGTGTAGCACAGAAATGG - Intronic
1062265230 9:135683825-135683847 GGCCAAGGTGAGCACAGCATGGG + Intergenic
1203784220 EBV:118309-118331 GTCCCTTTGGAGGACAGCGTGGG + Intergenic
1187428910 X:19203646-19203668 GACCATGTGGACCACATCACAGG + Intergenic
1190388831 X:49911756-49911778 GTCCATGTGCAGCACCGGAAAGG + Intergenic
1190501080 X:51079267-51079289 GTTCATGTTGAGCACTGCAGTGG + Intergenic
1195590418 X:106618568-106618590 GTCCATGTTGAGACCAGCCTAGG + Intronic
1198339351 X:135699089-135699111 GTTCCTGTGGAGTACAGCAAGGG - Intergenic
1201779262 Y:17700569-17700591 GTCCAGTTGGAGCACAGAAATGG + Intergenic
1201822294 Y:18205423-18205445 GTCCAGTTGGAGCACAGAAATGG - Intergenic