ID: 1171481333

View in Genome Browser
Species Human (GRCh38)
Location 20:25458015-25458037
Sequence TTGGGCCCGGCAGGTGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171481333_1171481339 5 Left 1171481333 20:25458015-25458037 CCCACGGCACCTGCCGGGCCCAA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1171481339 20:25458043-25458065 CACCCTCTGCTCTCTGCCCTCGG 0: 1
1: 0
2: 11
3: 94
4: 590
1171481333_1171481342 12 Left 1171481333 20:25458015-25458037 CCCACGGCACCTGCCGGGCCCAA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1171481342 20:25458050-25458072 TGCTCTCTGCCCTCGGCCTCTGG 0: 1
1: 0
2: 5
3: 40
4: 397
1171481333_1171481345 27 Left 1171481333 20:25458015-25458037 CCCACGGCACCTGCCGGGCCCAA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1171481345 20:25458065-25458087 GCCTCTGGTCCCTGTTCCCCTGG 0: 1
1: 0
2: 4
3: 86
4: 1122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171481333 Original CRISPR TTGGGCCCGGCAGGTGCCGT GGG (reversed) Intronic
900353333 1:2247759-2247781 CTGGGCCCCACAGGTGCCCTTGG + Intronic
900476912 1:2880281-2880303 TGCGGCCCGGCAGGTGCTCTGGG + Intergenic
900643909 1:3700143-3700165 TTGGGCCTGGCAGGGGTGGTGGG - Intronic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
910410653 1:86940911-86940933 TTGAGCCTGGGAGGTGCAGTCGG + Intronic
913453467 1:119008084-119008106 TTGGGCCGGGCCGGGGCCGCCGG - Intergenic
915313439 1:155015832-155015854 AAGGGCCCGGCAGGGGCCATGGG + Intronic
922100109 1:222472541-222472563 TTGGGGCCTGCAGATGCCATCGG + Intergenic
922100316 1:222473369-222473391 TTGGGGCCTGCAGATGCCATCGG + Intergenic
922734335 1:227971370-227971392 TTGGGGCCTGCAGATGCCATCGG - Intergenic
922734623 1:227972502-227972524 TTGGGGCCTGCAGATGCCATCGG - Intergenic
922734909 1:227973644-227973666 TTGGGGCCTGCAGATGCCATCGG - Intergenic
923490221 1:234478183-234478205 CTGGGGCCCGCAGGTGCAGTCGG + Exonic
924343309 1:243054206-243054228 TTGGGGCCTGCAGATGCCATCGG + Intergenic
1066732538 10:38448817-38448839 TTGGGGCCTGCAGATGCCATTGG - Intergenic
1066733167 10:38451323-38451345 TTGGGGCCTGCAGATGCCATCGG - Intergenic
1070329881 10:75409317-75409339 TAGAGCCAGGCACGTGCCGTCGG + Intergenic
1072847318 10:98845991-98846013 TTGGGCCTGGCATGTGGTGTGGG + Intronic
1076734509 10:132452702-132452724 TGGGGCCTGGCAGGTGCAGCAGG - Intergenic
1081716716 11:45255731-45255753 TGGGGGCTGGCAGGTGCAGTGGG + Exonic
1084296304 11:68214818-68214840 TTGGTGCCGGCAGGTGCCCAAGG + Intergenic
1087778200 11:102275820-102275842 TTGGGGCCAGCAGGTTCTGTGGG + Intergenic
1094836596 12:34325011-34325033 TTGGGCGCGACAGGTACCGTTGG + Intergenic
1103303802 12:119948468-119948490 TTGGGCCAGGCATGTGCCTTAGG + Intergenic
1107400005 13:40060489-40060511 TTGGGCCTGGCAGGTCCCCAGGG + Intergenic
1107945939 13:45418054-45418076 TTGGGTCGGGCCGGTGCCGCGGG - Intronic
1112718062 13:102209542-102209564 TAGGGCCAGGCAGGTCCCTTTGG + Intronic
1112954903 13:105044536-105044558 TTGGGGCTGGCAGGTGACATGGG + Intergenic
1113923946 13:113929999-113930021 TTGGGCCAGGGAGGAGCCCTCGG + Intergenic
1120834359 14:89027118-89027140 TTGGATCCGGCAGGTGCGGGAGG - Intergenic
1122324977 14:100876391-100876413 TGTGGCCCGCCAGGTCCCGTGGG + Intergenic
1126746336 15:51829775-51829797 TTGCGGCCGGCAGTTTCCGTGGG + Exonic
1132746015 16:1436638-1436660 TTGGGCCTTGGAGGTGGCGTGGG - Intronic
1134763532 16:16735149-16735171 CTGGGCCCGGCCGGTGACATTGG + Intergenic
1134982520 16:18624008-18624030 CTGGGCCCGGCCGGTGACATTGG - Intergenic
1137403990 16:48175907-48175929 TGGAGCCTGGCAGGTGCCATGGG - Intronic
1138660193 16:58512119-58512141 CTGGGCCCAGCTGGTGCTGTAGG + Exonic
1141699482 16:85635901-85635923 CTGGGCCCAGCAGCGGCCGTGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1146281771 17:31549626-31549648 TCGGGCCGGGCAGGGTCCGTGGG - Intergenic
1147170827 17:38617759-38617781 GTGGGCCCTGCAGGTGCCCACGG + Intergenic
1151556177 17:74847818-74847840 CTGGGCCCGGCAGGAGGGGTGGG - Intronic
1151625077 17:75271273-75271295 GGGGGCCCGGCAGGTGGCGCGGG - Intergenic
1152556312 17:81054877-81054899 GTTGGCCCCGCAGGTGCCCTTGG + Intronic
1152795639 17:82304736-82304758 TGGGGCCCGGGAGCTGGCGTTGG - Intergenic
1153772319 18:8425953-8425975 TGGGGCAAGGCAGGTGCAGTGGG - Intergenic
1156475101 18:37400990-37401012 TTGGGCCTGGCAGGGGCCCTGGG + Intronic
1160965561 19:1745671-1745693 TTGGGCTGGGCAGGAGCCGTTGG - Intergenic
1162322361 19:9977655-9977677 TTGGGCCCAGCAGGAGGCATTGG - Exonic
1162523648 19:11195539-11195561 CTGGGGCCGGCAGGTACCTTGGG + Exonic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1166636226 19:44453840-44453862 TTGGGCCCGGCATGTGGGGAGGG - Intergenic
1166637091 19:44459909-44459931 TTGGGCCCGGCATGTGGGGAGGG - Intergenic
1166960355 19:46493156-46493178 CTGCGCCTGGCAGGTGCTGTAGG - Exonic
926656336 2:15411091-15411113 TTGGCCCCAGCAGCTGCTGTAGG - Intronic
927173998 2:20392608-20392630 CTGGGCCTGGCTGGTGCCCTTGG + Intergenic
931722140 2:65074651-65074673 TTTGGGCTGGCAGGTGCAGTGGG + Intronic
938583860 2:132670456-132670478 GAGGGCGCAGCAGGTGCCGTGGG + Intronic
941099409 2:161280428-161280450 TTGGGCCCGGCACGTGGGGAGGG + Intergenic
946851132 2:223908403-223908425 TTGGGCCTGGCTAGTGCCTTTGG - Intronic
947792699 2:232876987-232877009 TTGGGGAGGGCAGGGGCCGTCGG + Intronic
948265992 2:236635711-236635733 TGGGGCCCAGCAGGTGCGGCGGG - Intergenic
948983593 2:241507578-241507600 TTGGGCTGGGCAGGGGCTGTAGG - Intronic
1169028064 20:2386381-2386403 TTGGGCAGGGGAGGTGCCGGGGG + Intronic
1169032085 20:2417448-2417470 CTGGGCCCGGGAGGTGAGGTTGG - Exonic
1171481333 20:25458015-25458037 TTGGGCCCGGCAGGTGCCGTGGG - Intronic
1172606500 20:36217667-36217689 TTGAGCCCGGAAGCTGCCCTTGG + Intronic
1175948448 20:62569713-62569735 GTGGGCGCAGCAGGTGCGGTGGG - Intronic
1179985470 21:44918418-44918440 CTGGGCCTGGCAGGAGCCCTGGG + Intronic
1180784327 22:18538514-18538536 CTGGTCCCGGGAGGTGCAGTCGG + Intergenic
1181127902 22:20712567-20712589 CTGGTCCCGGGAGGTGCAGTCGG + Exonic
1181241230 22:21477871-21477893 CTGGTCCCGGGAGGTGCAGTCGG + Intergenic
1183307336 22:37089684-37089706 TGGGGCCCTGCAGGTGCCACAGG + Exonic
1184340155 22:43881548-43881570 TTGGGCCCATCAGGTGAGGTGGG - Exonic
1184472671 22:44704534-44704556 TGGAGCCCTGCAGGTGCCGCGGG - Intronic
1184598214 22:45526857-45526879 CTGGGCCTTGCAGATGCCGTCGG + Intronic
1185082469 22:48717665-48717687 TCGGGCACTGCAGGTGCCATTGG + Intronic
954590362 3:51777472-51777494 GTGGGCCCTGCAGGAGCGGTGGG - Intergenic
962709920 3:138077693-138077715 GAGGGCTCGGCAGGTGCAGTAGG - Intronic
962820633 3:139044649-139044671 CTGGGCCTGGCAGGGGACGTGGG + Exonic
967779498 3:193419846-193419868 TTGGGCCCTGGAGGGGCAGTGGG - Intronic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
968940829 4:3636751-3636773 TTGAGCCCGGTGGGTGGCGTGGG - Intergenic
973326097 4:48863681-48863703 GTGGGACAGGCAGGTGCAGTGGG - Intergenic
975611979 4:76212940-76212962 TTGGGCTGGGCAGGGGCAGTTGG - Intronic
978207155 4:106092470-106092492 TTGGGCCGGGCAGGAGCCCACGG + Intronic
979328853 4:119406292-119406314 TTGGGGCCTGCAGATGCCATCGG + Intergenic
979609055 4:122670502-122670524 TTGGGCCCTGCAGGAGCCCACGG - Intergenic
983054450 4:163085278-163085300 TTGGGCAAGGCAGTTGCCTTAGG - Intergenic
1001056546 5:168454685-168454707 CTGGACACGGCAGGTGCAGTAGG + Intronic
1003260369 6:4511029-4511051 GTGGGCACTGCAGGTGCGGTGGG + Intergenic
1007325105 6:41053609-41053631 GTGGGCCCGGCAGGGGTGGTAGG + Intronic
1020232581 7:6331113-6331135 TTGTGCCAGGCAGGTGCCGAGGG + Exonic
1024648383 7:51386786-51386808 TTGGGGCCTGGAGATGCCGTCGG + Intergenic
1025052232 7:55741255-55741277 TTGGGGCCTGGAGATGCCGTCGG + Intergenic
1025959109 7:66205157-66205179 CTGGGTCCGGCAGGCGCCGAGGG - Intergenic
1032051729 7:128654260-128654282 TTGGGGCCTGCAGATGCCATCGG - Intergenic
1034252217 7:149701635-149701657 GTGGGCCTGTCAGGTGCCCTTGG - Intergenic
1034515889 7:151579103-151579125 TTGAGCCCGGCAGGGGCAGCGGG - Intronic
1037961496 8:23101800-23101822 TGGGGCCTGGCAGGTGCCCAGGG + Intronic
1039546270 8:38413556-38413578 GTGGGCCCAGCAGGGGCTGTGGG + Exonic
1041932358 8:63300797-63300819 CTGGGCCCTGAAGATGCCGTAGG + Intergenic
1045431191 8:102116561-102116583 TTGGGCCCGGGAGGTGGAGGCGG - Intronic
1048964732 8:139607441-139607463 GTGGGCCCGGCAGCTCCCGGGGG - Intronic
1049719370 8:144108535-144108557 CTGGGCCCGCTGGGTGCCGTGGG + Exonic
1051493313 9:17691111-17691133 TTGGTCTCGGCAGGTGCCACAGG + Intronic
1053493218 9:38527116-38527138 TTGAGCCAGGCAGGTGCCAAGGG - Intergenic
1055993265 9:82130777-82130799 ATGGGCGGGGCAGGTGCCCTGGG + Intergenic
1057183039 9:93040077-93040099 TTGGGCCCAGCCGGTGCCTGGGG + Intergenic
1057673903 9:97121678-97121700 TTGTGCCAGGCAGGTGCCGAGGG - Intergenic
1062657462 9:137611719-137611741 CTGGGCCTGGCAGCTGCCGAGGG + Intronic
1203567765 Un_KI270744v1:106043-106065 TTGGGCCCGGCATGTGGGGAGGG - Intergenic
1203568825 Un_KI270744v1:113028-113050 TTGGGCCCGGCATGTGGGGAGGG - Intergenic
1190106225 X:47562913-47562935 TGGGGCTGGGCAGGTGCCATGGG - Exonic
1190285528 X:48958511-48958533 TTGGGACAGACAGGCGCCGTGGG + Intergenic
1196443934 X:115735694-115735716 TTGGGCCGGGAAGGTTCCGTTGG + Intergenic
1202381018 Y:24276637-24276659 TTGGGGCCTGCAGATGCCATTGG - Intergenic
1202489767 Y:25393489-25393511 TTGGGGCCTGCAGATGCCATTGG + Intergenic