ID: 1171482666

View in Genome Browser
Species Human (GRCh38)
Location 20:25465643-25465665
Sequence GCCGTCCCTGCTCTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171482666_1171482668 15 Left 1171482666 20:25465643-25465665 CCACATCACAGAGCAGGGACGGC No data
Right 1171482668 20:25465681-25465703 TGTCTGAATGCCTGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171482666 Original CRISPR GCCGTCCCTGCTCTGTGATG TGG (reversed) Intronic