ID: 1171482666

View in Genome Browser
Species Human (GRCh38)
Location 20:25465643-25465665
Sequence GCCGTCCCTGCTCTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171482666_1171482668 15 Left 1171482666 20:25465643-25465665 CCACATCACAGAGCAGGGACGGC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1171482668 20:25465681-25465703 TGTCTGAATGCCTGACCCACAGG 0: 1
1: 0
2: 7
3: 30
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171482666 Original CRISPR GCCGTCCCTGCTCTGTGATG TGG (reversed) Intronic
900086778 1:902353-902375 GCCGTCCTTCCTCTGAGACGAGG - Intergenic
900509759 1:3053003-3053025 GGTGTCCCTTCTCTGTGCTGGGG + Intergenic
901171139 1:7258513-7258535 TCAGTCCCTGCTGTGTGTTGGGG - Intronic
901491074 1:9596623-9596645 GCAGGCCCTGCTCTGTGCTCAGG + Intronic
902801373 1:18832170-18832192 CCCTTCCCTTCTGTGTGATGGGG - Intergenic
903761135 1:25699616-25699638 GACGCCCACGCTCTGTGATGGGG - Intronic
905263921 1:36738329-36738351 TCCTTGCTTGCTCTGTGATGTGG - Intergenic
912316925 1:108675640-108675662 GCCGCCCATCCTCTGAGATGTGG + Intergenic
916720813 1:167483711-167483733 GCAGTGCCTGCTCTGGGAGGTGG + Intronic
917553267 1:176057905-176057927 GCCGCCCATCCTCTGAGATGTGG + Intronic
917919110 1:179734942-179734964 GCCATTCCTGTTATGTGATGTGG + Intergenic
918938028 1:190950167-190950189 GCTGCCCCTTCTCAGTGATGGGG + Intergenic
920581230 1:207109681-207109703 GCAGACCCTACACTGTGATGAGG - Intronic
920650751 1:207835581-207835603 GCCTTCCCACCTGTGTGATGAGG - Intergenic
922306572 1:224350090-224350112 GCCGCCCATCCTCTGAGATGTGG - Intergenic
923840899 1:237669674-237669696 GCCGCCCATCCTCTGAGATGTGG - Intronic
1067177021 10:43957325-43957347 GGCTTCACTGCTGTGTGATGTGG + Intergenic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG + Intronic
1069987323 10:72293285-72293307 CCTGTCCCTGCTGTGTGAGGTGG + Intergenic
1070367435 10:75750546-75750568 GCCGCCCGTCCTCTGAGATGTGG - Intronic
1071470758 10:85982585-85982607 CCCGTGGCAGCTCTGTGATGTGG + Intronic
1074999609 10:118785763-118785785 GCCTTGAATGCTCTGTGATGTGG - Intergenic
1076976798 11:178508-178530 CCCGTCCCGTCTCTGTGAAGGGG - Intronic
1077267664 11:1660069-1660091 ACTGTCTCTGCTGTGTGATGAGG + Intergenic
1077373864 11:2196031-2196053 GCCGTCCCTGGGCTGTGCTGTGG + Intergenic
1086017170 11:82181813-82181835 GCCGCCCATGGTCTGAGATGTGG + Intergenic
1086697210 11:89860630-89860652 GCCGCCCATCCTCTGAGATGTGG + Intergenic
1086708949 11:89983857-89983879 GCCGCCCATCCTCTGAGATGTGG - Intergenic
1089169442 11:116501896-116501918 CCCGTCCCTCCCCTGTGAAGTGG - Intergenic
1091770329 12:3147258-3147280 ACGGTCCCTGCCCTGGGATGAGG + Intronic
1093136561 12:15459246-15459268 ACCCTCCCAGGTCTGTGATGGGG + Intronic
1096063911 12:48724636-48724658 GCCGCCCATCCTCTGAGATGTGG + Intergenic
1096266933 12:50131017-50131039 GCCTTCCCTGTTCTTTGAAGTGG - Intronic
1096776750 12:53969075-53969097 CCCGCCTCTGCTCTGTGGTGAGG + Intergenic
1097184135 12:57187573-57187595 CCCTTCCCTGCTGTGTGATCTGG + Intronic
1097228667 12:57495426-57495448 GCCGCCCATGGTCTGAGATGTGG - Intronic
1097442538 12:59628595-59628617 GCCTCCCCTGCTATGTGGTGAGG + Intronic
1098333175 12:69375328-69375350 GCCGCCCATCCTCTGGGATGTGG - Intronic
1099007938 12:77257300-77257322 GCCTTCCCAGGTCTGTGATGTGG + Intergenic
1102132939 12:110547316-110547338 CACTTCCCAGCTCTGTGATGGGG + Intronic
1103924143 12:124414447-124414469 CCTGGCCCTGCTGTGTGATGGGG - Intronic
1104996223 12:132659183-132659205 GCCCTCACCTCTCTGTGATGAGG + Intronic
1106675196 13:31950988-31951010 GCCTTCACTGTGCTGTGATGAGG - Intergenic
1106759761 13:32857253-32857275 GCTGTCTCTCCTCTGTGCTGGGG + Intergenic
1111144072 13:84157610-84157632 CCCATCCCAGCTCTGTGATGAGG + Intergenic
1113469467 13:110534136-110534158 GCAGACAGTGCTCTGTGATGTGG + Intronic
1113684762 13:112275276-112275298 GCCGTCCCTCCTCTGAGAAACGG + Intergenic
1113821425 13:113216256-113216278 GCAATCCCTGCTCTCAGATGTGG - Intronic
1116502061 14:45634971-45634993 GCCGTCCATCATCTGGGATGTGG + Intergenic
1119703751 14:76771605-76771627 GCCCTCCCTTCTCTGTTCTGCGG + Intronic
1122288209 14:100665398-100665420 GCCATTCCTGCTGTGTGCTGGGG + Intergenic
1123995078 15:25712801-25712823 GAGGTCACAGCTCTGTGATGGGG + Intronic
1125785526 15:42313655-42313677 GGGGTCCCTGCTCTGTGATATGG - Intronic
1125833510 15:42732085-42732107 GCCTTCCCTGATTTGTGCTGTGG - Intronic
1125886851 15:43235713-43235735 GCTGTCCTGGCTCAGTGATGTGG + Exonic
1126089386 15:45038012-45038034 GCGGTCCCTGATGTCTGATGTGG + Intronic
1126210751 15:46098224-46098246 GCCGCCCATCCTCTGGGATGTGG - Intergenic
1127788696 15:62378962-62378984 GCCTTGGCTGCACTGTGATGGGG + Intergenic
1128647906 15:69390491-69390513 GAGGTCCCTGCTCTTTGATTCGG + Intronic
1129226937 15:74175614-74175636 GCTGGCACTGCACTGTGATGTGG + Exonic
1131094614 15:89647564-89647586 GCCTTCCCCGCACTGTGAAGCGG + Intronic
1132577998 16:672693-672715 TCTGTCCCAGCTCTGTGAGGTGG + Exonic
1132869767 16:2110696-2110718 GCCGTACCTGTTCTCTGCTGTGG - Exonic
1133108833 16:3533438-3533460 CCCCTCCCTGTTCTGTGCTGGGG + Intronic
1134717654 16:16364905-16364927 GCCGTACCTGTTCTCTGCTGTGG + Intergenic
1134957098 16:18387254-18387276 GCCGTACCTGTTCTCTGCTGTGG - Intergenic
1136453643 16:30368880-30368902 GTCATCCCTGCTCTTTGATGGGG - Intronic
1138400622 16:56740411-56740433 GCCGCCCATCCTCTGAGATGTGG - Intronic
1139407935 16:66734302-66734324 GTCTTCCCTGCAGTGTGATGCGG - Exonic
1141991985 16:87615781-87615803 GCCTTCCCTCCTCTGCAATGAGG + Intronic
1142443619 16:90119666-90119688 CCCGTCCCGTCTCTGTGAAGGGG + Intergenic
1142463811 17:115549-115571 CCCGTCCCGTCTCTGTGAAGGGG - Intergenic
1144490142 17:15701292-15701314 GCACTCCCTTCTTTGTGATGTGG + Intronic
1144910821 17:18680665-18680687 GCACTCCCTTCTTTGTGATGTGG - Intronic
1145174075 17:20684974-20684996 GCCGCCCATGGTCTGAGATGTGG + Intergenic
1147170663 17:38616979-38617001 GCGGTCCCTGCCCTGTTCTGGGG - Intergenic
1147702932 17:42407164-42407186 GCCTCCCCTGCTCTCTGATGAGG - Intronic
1147974119 17:44237983-44238005 GCCGCCCATCCTCTGAGATGTGG + Intergenic
1148231695 17:45939746-45939768 GCTGTTCCTGCTCTGTGACTTGG - Intronic
1149625163 17:58074638-58074660 GCCGCCCATCCTCTGAGATGTGG - Intergenic
1151719841 17:75848774-75848796 GCTGGGCCTGCACTGTGATGGGG + Intronic
1157319227 18:46621425-46621447 GCCGGCCCTGATCTGTGCTTAGG + Intronic
1160708212 19:539665-539687 GCCGTGCCTGGTCGGTGATAGGG + Intronic
1161586883 19:5110540-5110562 GCCCTACCTGCTCTGGGGTGGGG + Intronic
1161723341 19:5915413-5915435 CCCCTCCCCGCTCTGTGGTGTGG - Exonic
1165008447 19:32825036-32825058 TCAGTCCCAGCTCTGTGATCAGG + Intronic
1167174924 19:47859061-47859083 GCAGTACCTGATCAGTGATGAGG + Intergenic
925768283 2:7258888-7258910 GCAGTGTCTGCTCTGGGATGGGG + Intergenic
925844209 2:8020756-8020778 GCCATGCCTGCCCTGTGATGAGG + Intergenic
928090136 2:28368878-28368900 TCCCTTCCAGCTCTGTGATGAGG + Intergenic
929567878 2:43000870-43000892 GCTCCCTCTGCTCTGTGATGGGG + Intergenic
935717928 2:105954910-105954932 GCGGTCCCTGTGCTGTGCTGAGG + Intergenic
936658206 2:114512816-114512838 GCAGTCCCTGATCCTTGATGAGG - Intronic
937168808 2:119844638-119844660 GCCGCCCATCCTCTGAGATGTGG - Intronic
938236757 2:129711744-129711766 GCAGACCCTGCTCAGTGGTGGGG + Intergenic
938266872 2:129934191-129934213 GCTGGCCCTGCTCTGTGCCGTGG - Intergenic
938422682 2:131156883-131156905 GCCGTCCCTGCTGTGTGGCCTGG - Intronic
942134310 2:172910023-172910045 GCCATGCGTGCTCTGTGATTTGG + Intronic
943100286 2:183479080-183479102 GCCGACCGTCCTCTGAGATGTGG + Intergenic
946306915 2:218861216-218861238 GCAATCCCTACTCCGTGATGCGG + Intronic
946742534 2:222816166-222816188 GCCGCCCATCCTCTGAGATGTGG + Intergenic
948075888 2:235164947-235164969 GCCGTCCCTGCTCTGTGTGCAGG - Intergenic
948261045 2:236604753-236604775 GCCCTCCCTGCACAGTGTTGTGG + Intergenic
948375085 2:237515956-237515978 TCACTCTCTGCTCTGTGATGTGG - Intronic
948619296 2:239224066-239224088 GCAGACCCTGCGCTGGGATGAGG - Intronic
948903562 2:240967662-240967684 GACGTCACTCCTCTGTGCTGGGG - Intronic
1169855610 20:10099228-10099250 GCCCTCCCTTCTCTTTGAGGTGG - Intergenic
1171482666 20:25465643-25465665 GCCGTCCCTGCTCTGTGATGTGG - Intronic
1172379292 20:34475041-34475063 GCCGCCCATGGTCTGGGATGTGG - Intronic
1174330315 20:49812634-49812656 AACGTCCCCGCCCTGTGATGGGG + Intergenic
1175367431 20:58465808-58465830 GTCGTCCCTGCTTTGAAATGAGG + Intronic
1178371189 21:32028857-32028879 GTGGTCCCTGGTCAGTGATGGGG - Intronic
1179588379 21:42388658-42388680 AGAGTCACTGCTCTGTGATGGGG - Intronic
1179913439 21:44461855-44461877 GCCCTCCGTGCTATGTGCTGTGG - Exonic
1181301580 22:21884166-21884188 GCCGTCCATCGTCTGAGATGTGG - Intergenic
1181466860 22:23115072-23115094 GCTGGCCTTGCTCTGTGCTGTGG + Intronic
1181491933 22:23265576-23265598 GACTTCCCTGCTCTGGGTTGTGG + Intronic
1182465930 22:30516192-30516214 GCCATCCCTTCTCAGTGGTGGGG + Intergenic
1182564055 22:31184341-31184363 GCCGCCCATCCTCTGGGATGTGG - Intronic
1183630276 22:39028376-39028398 ACCGCCCCAGCTCTGTGGTGTGG + Intronic
1183786005 22:40029603-40029625 GCCTGCCCTGCCCTGTGCTGTGG + Exonic
1183862451 22:40679750-40679772 GCCCTCCCTCCTCTGGGCTGTGG + Intronic
1184145449 22:42607678-42607700 GCCGTCCATCGTCTGAGATGTGG + Intronic
1184293878 22:43511921-43511943 GCCGTCCCTGAGCAGAGATGGGG + Intergenic
1184429962 22:44436894-44436916 GCCGTCCCTGCTGTGGCACGTGG + Intergenic
1184564968 22:45286369-45286391 TGCTTCCCTGCTCTGTAATGGGG - Intronic
1184724810 22:46337631-46337653 GCAGTCCCTGCTTTGCCATGTGG - Intronic
1184742099 22:46434479-46434501 GCCCTCCGGGCTCTGTGAGGTGG - Intronic
1185203190 22:49521146-49521168 GCCGTCCCTCCACTGCGATGCGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
953352918 3:42229620-42229642 GTGGTCCCTGCCCTGTGATGGGG - Intergenic
953440202 3:42909894-42909916 GCCGCCCATCCTCTGGGATGTGG - Intronic
954991986 3:54849407-54849429 TGAGTCCCTGCTCTGTGCTGAGG - Intronic
956346372 3:68283747-68283769 CCCATCCCTGCTTTGTGCTGTGG - Intronic
960526748 3:118718772-118718794 GCCGCCCATCCTCTGAGATGTGG - Intergenic
962818117 3:139020612-139020634 GCCTTCCCTGCTCCCTGGTGGGG - Exonic
967220832 3:187246633-187246655 GTGGTCCCAGCTCTGTGCTGTGG - Intronic
968363910 3:198170715-198170737 CCCGTCCCGTCTCTGTGAAGGGG + Intergenic
968610581 4:1555147-1555169 GCCGCCCCTGCCCTGTGAGCTGG + Intergenic
972390136 4:38606353-38606375 AAAGTCCCTGCTTTGTGATGAGG - Intergenic
976339957 4:83935719-83935741 CTCGTCACAGCTCTGTGATGAGG + Intergenic
980901803 4:138912143-138912165 ACCCTCCCTGTTCTGGGATGTGG + Intergenic
982026209 4:151255412-151255434 GCCGCCCATCCTCTGAGATGTGG - Intronic
982358290 4:154491974-154491996 CCCCTCCCTGCCGTGTGATGCGG + Intergenic
982600446 4:157443097-157443119 TGTGGCCCTGCTCTGTGATGTGG + Intergenic
985759396 5:1737372-1737394 GCCGTCTCTGTTCAGTGCTGAGG - Intergenic
986577531 5:9228156-9228178 GCTGTCCATGCACTGTAATGAGG + Intronic
995193245 5:109341250-109341272 GCCGCCCATCCTCTGAGATGTGG + Intronic
998058547 5:139100434-139100456 GCCTGCACAGCTCTGTGATGCGG - Intronic
1001845240 5:174916388-174916410 GCCGCCCCTGCTGGGGGATGGGG - Intergenic
1002171881 5:177379273-177379295 GCCTTGCCTGCTCTGTGCTGGGG + Intronic
1002483961 5:179522429-179522451 GAGGCCCCAGCTCTGTGATGTGG + Intergenic
1002500602 5:179645052-179645074 GAGGCCCCAGCTCTGTGATGTGG - Intergenic
1005348513 6:24912228-24912250 GGAGTGCCTGCTCTGTGCTGGGG - Intronic
1006906072 6:37534564-37534586 GCCGTTCCTGCTCTGGGAAGGGG + Intergenic
1006910350 6:37559394-37559416 GCAGTCCCTGCCCTGTGCAGGGG - Intergenic
1007956480 6:45922302-45922324 GCCCACCCTCCTCTGTGGTGGGG + Intronic
1008553798 6:52656305-52656327 GCCGCCCATCCTCTGAGATGTGG - Intergenic
1011195795 6:84777998-84778020 GTCCTCCCTGCTATGTCATGTGG - Intergenic
1011466337 6:87661129-87661151 GCAGTCCCTGCTATGTAATAAGG - Intronic
1016061705 6:139637285-139637307 GCAGTCACTGCTGTGGGATGGGG + Intergenic
1018000345 6:159573114-159573136 GCCGTCCCAGCTCTGAGATGAGG + Intergenic
1018712699 6:166508169-166508191 GCCCGCCCTCCTGTGTGATGTGG + Intronic
1019251903 7:18949-18971 CCCGTCCCGTCTCTGTGAAGGGG - Intergenic
1020336368 7:7065432-7065454 GGCGTACCTCCTCTGTGATATGG - Intergenic
1023787230 7:43719911-43719933 CTCCTCCCTGTTCTGTGATGTGG - Intronic
1024397515 7:48886780-48886802 GCTGGCCCTGGTCTGTGGTGAGG + Intergenic
1026308694 7:69165765-69165787 GACGTCCCTGCTCTAGGCTGTGG + Intergenic
1026982767 7:74536309-74536331 GCCAGCCCTGCTCTGGGCTGAGG + Intronic
1029650101 7:101885679-101885701 GCCATGCCTGCTCTGTGCTCGGG - Intronic
1034135248 7:148761972-148761994 GCCGTCCCTGATCTGACAGGAGG + Intronic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1035209675 7:157318555-157318577 GCTGTCTCAGCTCTGAGATGAGG + Intergenic
1037435857 8:18862346-18862368 GGAGTTCCTGCTCAGTGATGTGG - Intronic
1038611966 8:29066674-29066696 CCTGGCCCTGCTCTCTGATGAGG - Intergenic
1039019163 8:33186061-33186083 ACCGTGCCTGGCCTGTGATGGGG + Intergenic
1041362971 8:57071666-57071688 GCCGCCCATCCTCTGAGATGTGG - Intergenic
1041380312 8:57247993-57248015 GCCTTCCCTCCCCTGTGTTGGGG + Intergenic
1044861140 8:96525173-96525195 TCCGTTCCCACTCTGTGATGAGG + Intronic
1047414053 8:124649388-124649410 TCCATCGCTGCTCTGTGCTGGGG - Intronic
1047670671 8:127142860-127142882 GCCCTCACTGGACTGTGATGTGG - Intergenic
1048161696 8:132027416-132027438 GCAGTCCATGCACTGTGCTGAGG + Intronic
1049021625 8:139961201-139961223 GCTATCCCTGCTCTGTGTAGTGG - Intronic
1053457137 9:38241841-38241863 GCCGCCCATGGTCTGAGATGTGG + Intergenic
1053762610 9:41356818-41356840 GCCCTCCCGGGTCTGTGCTGAGG + Intergenic
1053887794 9:42657767-42657789 GCCCGCCCGGCTCTGTGCTGAGG - Intergenic
1054226814 9:62465217-62465239 GCCCGCCCGGCTCTGTGCTGAGG - Intergenic
1056583687 9:87914426-87914448 GAAGCCCCAGCTCTGTGATGCGG + Intergenic
1056584179 9:87917895-87917917 GAAGCCCCAGCTCTGTGATGCGG + Intergenic
1056612690 9:88135030-88135052 GAAGCCCCAGCTCTGTGATGCGG - Intergenic
1056613187 9:88138520-88138542 GAAGCCCCAGCTCTGTGATGCGG - Intergenic
1056615206 9:88159709-88159731 GCTGCCTCTGCTCTGGGATGAGG + Intergenic
1057304414 9:93904009-93904031 CCCGTGTCTGCTCTGTGACGAGG + Intergenic
1061497137 9:130981560-130981582 GCTGTCCCTGGCCTGGGATGGGG + Intergenic
1061783320 9:133008327-133008349 CCCGACCCTGCTCAGGGATGGGG + Intergenic
1061918595 9:133769951-133769973 GCCTTCCCTGTTCTGAGCTGTGG + Intronic
1062158706 9:135068075-135068097 GCCCTCCGTCCTCTGTCATGAGG - Intergenic
1062316608 9:135970454-135970476 GCCGTCCCTCCTCTGGGACTTGG + Intergenic
1062552443 9:137095785-137095807 GCGCCCCCTGCTGTGTGATGCGG - Intronic
1062748609 9:138234660-138234682 CCCGTCCCGTCTCTGTGAAGGGG + Intergenic
1186841204 X:13486322-13486344 GCCACCCCTGCTCTTTGCTGCGG - Intergenic
1192500198 X:71645333-71645355 GCCATCCATCCTCTGGGATGTGG - Intergenic
1195888915 X:109671195-109671217 GCCGCCCATCCTCTGGGATGTGG + Intronic
1200010300 X:153115334-153115356 GCCATCCATGCTCTGGGCTGAGG + Intergenic
1200029300 X:153284588-153284610 GCCATCCATGCTCTGGGCTGAGG - Intergenic
1200052858 X:153444106-153444128 TCTGTCCCTGCTCTGTGAAGTGG - Intergenic
1200324627 X:155224027-155224049 GCCGCCCATCCTCTGAGATGTGG - Intronic