ID: 1171486390

View in Genome Browser
Species Human (GRCh38)
Location 20:25489460-25489482
Sequence GGGAGTAAGGAGAAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2754
Summary {0: 1, 1: 0, 2: 25, 3: 363, 4: 2365}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171486390_1171486402 4 Left 1171486390 20:25489460-25489482 CCCCCCTCCTTCTCCTTACTCCC 0: 1
1: 0
2: 25
3: 363
4: 2365
Right 1171486402 20:25489487-25489509 CTAGAAGGTCACAAGACAGAAGG 0: 1
1: 0
2: 1
3: 24
4: 249
1171486390_1171486403 27 Left 1171486390 20:25489460-25489482 CCCCCCTCCTTCTCCTTACTCCC 0: 1
1: 0
2: 25
3: 363
4: 2365
Right 1171486403 20:25489510-25489532 ATTTTCCAGACTTAGATCTAAGG 0: 1
1: 0
2: 0
3: 19
4: 198
1171486390_1171486404 30 Left 1171486390 20:25489460-25489482 CCCCCCTCCTTCTCCTTACTCCC 0: 1
1: 0
2: 25
3: 363
4: 2365
Right 1171486404 20:25489513-25489535 TTCCAGACTTAGATCTAAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171486390 Original CRISPR GGGAGTAAGGAGAAGGAGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr