ID: 1171486934

View in Genome Browser
Species Human (GRCh38)
Location 20:25491897-25491919
Sequence TGCCTCCCTCCTTGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 357}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171486934_1171486942 19 Left 1171486934 20:25491897-25491919 CCTCCCTCCCAAGGAGGGAGGCA 0: 1
1: 0
2: 1
3: 42
4: 357
Right 1171486942 20:25491939-25491961 TGAATTCCCAAAGCAATCTGAGG 0: 1
1: 0
2: 4
3: 23
4: 244
1171486934_1171486948 30 Left 1171486934 20:25491897-25491919 CCTCCCTCCCAAGGAGGGAGGCA 0: 1
1: 0
2: 1
3: 42
4: 357
Right 1171486948 20:25491950-25491972 AGCAATCTGAGGAAGAGGTGGGG 0: 1
1: 0
2: 0
3: 38
4: 368
1171486934_1171486947 29 Left 1171486934 20:25491897-25491919 CCTCCCTCCCAAGGAGGGAGGCA 0: 1
1: 0
2: 1
3: 42
4: 357
Right 1171486947 20:25491949-25491971 AAGCAATCTGAGGAAGAGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 328
1171486934_1171486946 28 Left 1171486934 20:25491897-25491919 CCTCCCTCCCAAGGAGGGAGGCA 0: 1
1: 0
2: 1
3: 42
4: 357
Right 1171486946 20:25491948-25491970 AAAGCAATCTGAGGAAGAGGTGG No data
1171486934_1171486944 25 Left 1171486934 20:25491897-25491919 CCTCCCTCCCAAGGAGGGAGGCA 0: 1
1: 0
2: 1
3: 42
4: 357
Right 1171486944 20:25491945-25491967 CCCAAAGCAATCTGAGGAAGAGG 0: 1
1: 0
2: 0
3: 17
4: 252
1171486934_1171486939 -8 Left 1171486934 20:25491897-25491919 CCTCCCTCCCAAGGAGGGAGGCA 0: 1
1: 0
2: 1
3: 42
4: 357
Right 1171486939 20:25491912-25491934 GGGAGGCAGCATGAAACCCATGG 0: 1
1: 0
2: 6
3: 26
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171486934 Original CRISPR TGCCTCCCTCCTTGGGAGGG AGG (reversed) Intronic
900457304 1:2783523-2783545 TCCCTCTCTCCTTGGGGTGGAGG + Intronic
900673182 1:3868499-3868521 TGACTCCACCTTTGGGAGGGAGG - Intronic
901811398 1:11768697-11768719 TCCTTCCCTCCTTGGGAAAGGGG + Intronic
902541171 1:17156047-17156069 TGCCTCACTACTTGTGAGGCGGG - Intergenic
903432100 1:23312861-23312883 TCTCTCCTTCCTTGGGGGGGTGG - Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903953714 1:27011221-27011243 TTCCTAGTTCCTTGGGAGGGTGG + Intronic
904023806 1:27489797-27489819 TCCCTCCCTCCCTGAGGGGGTGG + Intronic
904039879 1:27577587-27577609 TGCTTCCTTGCTTGGGAGTGGGG - Intronic
905292412 1:36931306-36931328 TGCCTCTCTCCAGGGGAGGCTGG - Intronic
905638906 1:39575668-39575690 TGCCGCCCTCCTCGGCAGGAGGG + Intronic
905854722 1:41301810-41301832 TGCCTCCCTCCTGGGTAGTTGGG + Intergenic
906199061 1:43947576-43947598 TTGCTCCCTCCCTGGCAGGGAGG - Exonic
906611208 1:47204869-47204891 TGACACCATCCTTGGGAGGCCGG + Intergenic
908135188 1:61124856-61124878 GGCCTCCCTCCATGAGAGGAGGG + Intronic
910292784 1:85615605-85615627 TGCCTCCCTCCTTAGGGCGCAGG + Intergenic
910876762 1:91885724-91885746 GACCTCCGGCCTTGGGAGGGAGG - Intronic
914754808 1:150556718-150556740 TGCCCTCCTCCCTGGGAGGACGG - Exonic
915131284 1:153697373-153697395 TGCCTGCCTGCCTGGGAAGGAGG - Intergenic
915303168 1:154962969-154962991 TGCCTCCCTTTCTGGGAGGGCGG - Exonic
915308168 1:154993038-154993060 TCCCTCCCTCCTAGGGTGGGAGG - Exonic
915909847 1:159908186-159908208 TGCCTCCCTACTTATCAGGGTGG - Intergenic
916075533 1:161198123-161198145 TGCCTCCCTCCAGGGGCTGGAGG + Exonic
917481565 1:175416375-175416397 TGCCTCTATCCTTGGGAAGTAGG + Intronic
919732365 1:200921477-200921499 TGCCTGCATCCTTGGGTGGAGGG + Intergenic
920508563 1:206534182-206534204 TGGCTCCCTTCTGGGGAGAGGGG + Intronic
920701563 1:208221610-208221632 TGCACCCCACCTTGGGAGTGTGG + Intronic
922035822 1:221846870-221846892 TTCCTCCCTTCCAGGGAGGGAGG + Intergenic
922035823 1:221846872-221846894 CACCTCCCTCCCTGGAAGGGAGG - Intergenic
922727340 1:227928536-227928558 TGCCTCCTTCATTGTCAGGGTGG + Intronic
924083908 1:240428347-240428369 TGCCCAGCTACTTGGGAGGGTGG - Intronic
924593134 1:245422364-245422386 TGCCTCCCTCGCTGGGAGGTGGG - Intronic
1062860327 10:805288-805310 TGCCTCCCTGCTTTTGAGCGGGG + Intergenic
1062966522 10:1611589-1611611 TTCCTCCCTCCTTGGGAACAGGG + Intronic
1063093845 10:2891547-2891569 TGACTCCCGCCTTCGGAGGAGGG - Intergenic
1066041959 10:31557280-31557302 TGCCTCCCTCCTTAGGTGAGAGG - Intergenic
1066254015 10:33661585-33661607 TGCCTTACTCCGGGGGAGGGAGG + Intergenic
1067473776 10:46553489-46553511 GGCCCCCCTCCCTGGGAGGGTGG - Intronic
1069615899 10:69806062-69806084 TGCCTCCCTCCTGGGATTGGAGG + Intronic
1071355025 10:84785099-84785121 GGCCTCCCTTCTTGGTGGGGTGG + Intergenic
1072453235 10:95555765-95555787 TTCTGCCCACCTTGGGAGGGTGG - Intronic
1073324010 10:102632145-102632167 TGCCTCCATCGTTGGTTGGGTGG + Exonic
1073468486 10:103708373-103708395 TGGCTCCCTCAGTGGGAGGTTGG + Intronic
1073888573 10:108070223-108070245 TTCCTTCCTTCTTGTGAGGGTGG + Intergenic
1074085876 10:110208744-110208766 GGCCTCCTTCTTTGGGGGGGGGG - Intronic
1074113210 10:110437255-110437277 TGCCTGCCTGCTTCAGAGGGTGG + Intergenic
1075014812 10:118903046-118903068 TGACTCCCTTCTTGGAAAGGGGG - Intergenic
1075168008 10:120086622-120086644 TGCCTTTCTCCTTGAGTGGGAGG - Intergenic
1075580301 10:123612397-123612419 TGCCCCACTCCATGGAAGGGGGG - Intergenic
1075641341 10:124066766-124066788 CACCTCCCTCCTGGGGAGGTGGG + Intronic
1076290347 10:129340863-129340885 TGCCTCTCTCCTTGGCCTGGGGG + Intergenic
1077003238 11:335857-335879 TGCCCCCATGCGTGGGAGGGAGG + Intergenic
1077311439 11:1890628-1890650 GGCCTCCCACCTCAGGAGGGAGG - Exonic
1077680768 11:4237936-4237958 AGCCGCCCTGCCTGGGAGGGAGG + Intergenic
1080031291 11:27664346-27664368 TACCTCCCTCCCTAGGAGGGAGG + Intronic
1080031292 11:27664348-27664370 TACCTCCCTCCTAGGGAGGGAGG - Intronic
1080308054 11:30858107-30858129 TCCCTCCCTTCTGGGGAGTGTGG + Intronic
1080515181 11:33013997-33014019 TCCCTCACTGCATGGGAGGGGGG - Intergenic
1081596293 11:44461932-44461954 AGCCTCCCTCCCTGGAAGGAAGG + Intergenic
1081623772 11:44634735-44634757 AAGCTCCCACCTTGGGAGGGAGG - Intergenic
1083180866 11:60984319-60984341 TTGCTGCCTCCGTGGGAGGGAGG + Intronic
1083294640 11:61708717-61708739 TGCCTCCCTCTTGGGGTGGCTGG - Intronic
1083478875 11:62930737-62930759 AGGCTCCCTCCTAGGGAGGAGGG + Intergenic
1084266676 11:68008681-68008703 TCCCTGCCTACCTGGGAGGGCGG - Intronic
1084382950 11:68825354-68825376 TGCTTCCCTTCCTGGGAGGTGGG - Intronic
1084944392 11:72630982-72631004 TGCCCTCCCCCTTGGGAGGACGG - Intronic
1085426601 11:76410223-76410245 TTTCTCCCTCTTTGGGAGGCTGG - Intronic
1085643285 11:78206978-78207000 TGCCTCCCTCATTGGAAGGCAGG + Intronic
1087275482 11:96156413-96156435 GGTCTCCCTCCTTGAGAGGGAGG + Intronic
1089286957 11:117413566-117413588 TGCCTCCTTCCTGAGAAGGGAGG + Intergenic
1089498270 11:118918652-118918674 GACCTCCCTCCTCTGGAGGGAGG + Intronic
1089527112 11:119104380-119104402 CACCACCCTCCTGGGGAGGGTGG + Intronic
1090213916 11:124943467-124943489 AGCCTCCCTCTTTGGTAGGAGGG - Intergenic
1090363737 11:126189954-126189976 TGCCCACCTCCTAGGGAGGGAGG - Intergenic
1090836505 11:130458083-130458105 CTCCTTCCTCCTAGGGAGGGTGG - Intronic
1091673178 12:2467472-2467494 TTCCTCCCTTCTGGGGAGGCTGG - Intronic
1091775945 12:3184933-3184955 TGCCTCCCTGCTGGCCAGGGAGG - Intronic
1092172628 12:6383535-6383557 TCCCCCTCTCTTTGGGAGGGAGG + Intronic
1092195101 12:6544658-6544680 TGTCTCCCTCTTTTGGATGGTGG - Intronic
1092538434 12:9405877-9405899 TGCCTCCCCCCCTGCGATGGGGG - Intergenic
1092556614 12:9567802-9567824 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1093662324 12:21772074-21772096 TGCCTTCCTCCTTGAAAGGCTGG + Intronic
1094514041 12:31117754-31117776 TGCCTCCGTCCCTGCGATGGGGG - Intergenic
1094514120 12:31117991-31118013 TGCCTCCCCCCCTGCGATGGGGG - Intergenic
1094514884 12:31120431-31120453 TGCCTCCCCCCTTGCTATGGGGG - Intergenic
1094515059 12:31121028-31121050 TGCCTCCCCCCCTGCGATGGGGG - Intergenic
1096657958 12:53103514-53103536 TGCCTCCTTCCTTCGCAGTGTGG - Exonic
1096669744 12:53191544-53191566 TCCCTCCCTCCTTCAGAGAGTGG + Exonic
1096803140 12:54124860-54124882 GGCATCCCTCCTTGGCTGGGAGG + Intergenic
1096871650 12:54596260-54596282 TCTCTCCTTCCTTGGGAGGGAGG + Intergenic
1102463628 12:113115321-113115343 TGACTCCCACCTTGGGTGAGTGG - Intronic
1102491671 12:113293088-113293110 TGCCTCCCTCCTTCGGACCAGGG - Intronic
1102614596 12:114142366-114142388 TGGCTCCAGGCTTGGGAGGGAGG - Intergenic
1103453782 12:121048897-121048919 TGCCATCCTCCTTGGGAGCTGGG + Intergenic
1104013327 12:124947270-124947292 TCCATGCCTTCTTGGGAGGGTGG - Exonic
1104415098 12:128591423-128591445 TGCCTCCTTCCTTTGTATGGCGG + Intronic
1105889364 13:24671172-24671194 TGCCTCAGCCCTTGGGAGAGTGG + Intergenic
1106121293 13:26862094-26862116 TGCATCCATCATTGGCAGGGAGG - Intergenic
1106254685 13:28011633-28011655 TGCCCCCCTCCCCGGGTGGGAGG - Intronic
1106595223 13:31129774-31129796 TGCTTCCCTCCTTGGGAGCTGGG + Intergenic
1107940442 13:45377465-45377487 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107940579 13:45377861-45377883 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107940609 13:45377939-45377961 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107940638 13:45378018-45378040 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941110 13:45380247-45380269 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941168 13:45380404-45380426 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941198 13:45380482-45380504 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941227 13:45380561-45380583 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941392 13:45381306-45381328 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941468 13:45381542-45381564 TGCCTCCCCCCCTGAGATGGGGG + Intergenic
1107941557 13:45381787-45381809 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107941698 13:45382183-45382205 TGCCTCCCCCCCTGTGATGGGGG + Intergenic
1107941807 13:45382499-45382521 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1107943518 13:45396387-45396409 TGCATCCTTCCTTGGGAGGCAGG + Intronic
1108053061 13:46464246-46464268 TGCCTCCCCCCCTGCGATGGGGG - Intergenic
1108053150 13:46464482-46464504 TGCCTCCCCCCCTGCGATGGGGG - Intergenic
1108521517 13:51250928-51250950 TGCCTCACTCCCTGTGAGGCAGG + Intronic
1109537930 13:63740998-63741020 TGCCTCCCCCCTTGCGATGGGGG + Intergenic
1109538236 13:63741949-63741971 TGCCTCCCGCCCTGCGATGGGGG + Intergenic
1109545601 13:63837823-63837845 TGCCTCCCGCCCTGCGATGGGGG - Intergenic
1109545807 13:63838728-63838750 TGCCTCCCGCCCTGCGATGGGGG - Intergenic
1109546202 13:63840463-63840485 TGCCTCCCCCCCTGGGATGGGGG - Intergenic
1110891857 13:80705661-80705683 TGCCTCCCCCCCTGCGATGGGGG - Intergenic
1112036036 13:95497501-95497523 TGCCTCCCTCTTTGTGTGGCTGG - Intronic
1112541168 13:100314450-100314472 TCCCTCTCCCCTTTGGAGGGTGG + Intronic
1112788200 13:102974759-102974781 TCCCTCCTCCCTGGGGAGGGAGG - Intergenic
1114066198 14:19061792-19061814 TGCCTGCCTCCTGGGGAGCCCGG + Intergenic
1114096070 14:19338232-19338254 TGCCTGCCTCCTGGGGAGCCCGG - Intergenic
1116525381 14:45897617-45897639 TCCCTTCCTCCTTGGGAGAAGGG + Intergenic
1117057554 14:51928544-51928566 TCCCTCTATCCTTGGTAGGGTGG - Intronic
1117339146 14:54778985-54779007 AGGCTGCCTCCTTGGGAGGAAGG - Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118319795 14:64746525-64746547 TTCCTCCCTTCATGGGAGGGGGG - Exonic
1118321766 14:64757631-64757653 TCCCTTCCTCTCTGGGAGGGGGG + Intronic
1119307052 14:73615931-73615953 GGCCTAGCTACTTGGGAGGGTGG + Intronic
1119543048 14:75453077-75453099 TTCCTCCCTCCTGGAGTGGGAGG + Intronic
1122539809 14:102491818-102491840 TGCCATCCTACTGGGGAGGGTGG - Intronic
1122607726 14:102958606-102958628 TGCCTCCCTCCATGGGCCGCAGG - Intronic
1122717317 14:103703445-103703467 TGCCCCTCGCCTGGGGAGGGAGG + Intronic
1122810039 14:104283283-104283305 TGGCTCCCTCCGTGGGCGGGTGG + Intergenic
1122818588 14:104327992-104328014 TGCCATCCTCCTCTGGAGGGAGG + Intergenic
1122818589 14:104327994-104328016 TGCCTCCCTCCAGAGGAGGATGG - Intergenic
1123964312 15:25439358-25439380 TGCAACCCTCCTGGGGGGGGGGG - Intergenic
1124226753 15:27901590-27901612 TTCCACCCTCCTTGCGAGGTAGG - Intronic
1126150960 15:45523016-45523038 TGCCTCCCAGCCTGGGAAGGTGG - Intergenic
1127286009 15:57534403-57534425 TGCCTCCTGACTTGTGAGGGAGG + Intronic
1127617434 15:60701001-60701023 TGCCTCCTTCCTCGGGGTGGAGG - Intronic
1128998713 15:72316061-72316083 TGCCTCCCACCTCTGGAGGGAGG + Intronic
1129189814 15:73930683-73930705 CACCTCCCTCCATGGGTGGGTGG + Intronic
1129296542 15:74603253-74603275 GGCCTCACTCCTTGGCAGGGTGG - Intronic
1132057241 15:98661672-98661694 TGCCTCCATGCGTGGGAGAGAGG - Intronic
1132565650 16:621402-621424 TGCCTCCCTCCGTTAGAGAGTGG + Intronic
1132661670 16:1064297-1064319 TGCCTCCCGCCCTGGGAAGCTGG + Intergenic
1132666847 16:1084885-1084907 TGCCTCCCTCCATGGGGGCTTGG + Intergenic
1133020285 16:2964082-2964104 TCCCTCCCCCCATGGGAGGCCGG - Exonic
1133741968 16:8658695-8658717 TATCTCCGTCTTTGGGAGGGCGG + Intergenic
1134049662 16:11128586-11128608 GGCCTCCCTCTTTGCGGGGGTGG - Intronic
1135540288 16:23324758-23324780 TGCCTCCAGCATTGGCAGGGAGG + Intronic
1137005915 16:35274311-35274333 TGCTTCTCTCATTGGGAGGAGGG + Intergenic
1137600822 16:49755049-49755071 TGCCTCCCTCCTCAGCAGGAGGG + Intronic
1139160142 16:64495123-64495145 AGCTTCCCTTCTTGGGAAGGAGG + Intergenic
1139250633 16:65492139-65492161 TGCCTGCCTGCATGGGAGGGAGG - Intergenic
1140958343 16:79888557-79888579 TGTCTCTCTCCTTAGGAGGTTGG - Intergenic
1141055791 16:80812487-80812509 TGACTCCATCCTAGGGATGGGGG - Intergenic
1141445615 16:84055920-84055942 GGCCCGCCTCCTGGGGAGGGAGG + Intronic
1141545771 16:84767385-84767407 TGGCGCCCTTCTTGGAAGGGTGG + Intronic
1141933973 16:87224259-87224281 TGCCTGCTTCATCGGGAGGGAGG - Intronic
1142522066 17:511955-511977 TTCCTCCCTCCTGGGGCTGGTGG - Exonic
1144581182 17:16460450-16460472 TGCCTCTCTCTCTGAGAGGGTGG + Intronic
1144848361 17:18231624-18231646 TGGCTGCCTGCTTTGGAGGGAGG + Intronic
1145007292 17:19344846-19344868 TGGCTCCCTCCTTGGGGTTGGGG - Intronic
1145113949 17:20190798-20190820 TGCCTCCCTCCCTTGGGGGTGGG + Intronic
1145216771 17:21058731-21058753 TGCCTCCCTCCCTGGGGGCCTGG - Intergenic
1146183088 17:30709491-30709513 TGCGCCCCTCCCGGGGAGGGAGG - Intergenic
1146476546 17:33167259-33167281 TGGCTCACAACTTGGGAGGGTGG - Intronic
1147120282 17:38331441-38331463 TGCCTCGCTTCTTGGGCAGGTGG + Exonic
1148053348 17:44779818-44779840 TGCCTCCCTCCGTGGCTGGATGG - Exonic
1148075485 17:44933094-44933116 TGTCTCCCCACTTGCGAGGGTGG - Intronic
1148358804 17:46995203-46995225 TGACTCCCACTGTGGGAGGGAGG - Intronic
1148381428 17:47201328-47201350 TTCCTCCCTCCTTGGTGGGAAGG + Intronic
1148586460 17:48784708-48784730 TGCGTCCCCTCTTGGGAGGCAGG - Intronic
1149577793 17:57726527-57726549 TGCCTCCCCTCATGGGAGGGAGG + Intergenic
1150435084 17:65147442-65147464 TCCCACGCTCCTTGGGAAGGTGG + Intronic
1150787815 17:68176937-68176959 TGACTCCCACTGTGGGAGGGAGG + Intergenic
1151552553 17:74830383-74830405 GGCCTCTCTCCTTGGCAGGGAGG - Intronic
1152167842 17:78722485-78722507 AGCCTGCCCCCTTGGGAGGAGGG - Intronic
1152214735 17:79025368-79025390 CTCATCCCTGCTTGGGAGGGAGG + Intronic
1152312261 17:79558515-79558537 TGCCTCCCTCCTGGGCAGCCGGG - Intergenic
1152545941 17:81000171-81000193 TGGCTCCCTCTGTGGGAGCGTGG + Intronic
1156368159 18:36448589-36448611 CGCCTCCCTCTGTGTGAGGGAGG + Intronic
1157158359 18:45289272-45289294 TGCCTCCCACCTTGGGCTGGTGG - Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1158314008 18:56190501-56190523 TGCCTCCCTCTTGGGGGTGGTGG - Intergenic
1160403616 18:78629402-78629424 GGCCTCCCTCCTTGTGGGGTTGG - Intergenic
1160568652 18:79801859-79801881 TGAATCCCTCCATGCGAGGGCGG - Intergenic
1160994572 19:1876719-1876741 TGCCTGCTTCCTAGGGAGGCTGG - Intergenic
1162320513 19:9968606-9968628 TCCCTCCCTCCCTGGCTGGGGGG - Intronic
1162404063 19:10462877-10462899 TATCTCCCACCTGGGGAGGGAGG - Intronic
1162439408 19:10683315-10683337 TGCCTCCCTCCAGGGGCAGGGGG - Intronic
1162975706 19:14206277-14206299 TGCGCCCCTCCCGGGGAGGGAGG + Intergenic
1163233019 19:16016511-16016533 TGCCTCCATCCATGGGGTGGGGG + Intergenic
1164767358 19:30781981-30782003 GGCCTCACTCCTTGGGGTGGGGG + Intergenic
1165072947 19:33266046-33266068 TGCATCCCTCCTTGGCGGGGTGG + Intergenic
1165253386 19:34558104-34558126 TGCCTCTCTCAGTGGGAGGAGGG + Intergenic
1165907938 19:39204943-39204965 AGGCTCCCTCCCTGGGAGGCAGG + Intergenic
1166139580 19:40799035-40799057 TTCCTTTCTCCTTGGTAGGGGGG + Intronic
1166375298 19:42324266-42324288 TGCTTCCCGGCCTGGGAGGGGGG - Intronic
1167108663 19:47446269-47446291 TGCCTGCATCCTGGGCAGGGGGG + Intronic
1167299957 19:48672540-48672562 CGCCAGGCTCCTTGGGAGGGCGG - Intronic
926113048 2:10194846-10194868 TCCCTGCCTCCTTGGCATGGTGG + Intronic
927149649 2:20188308-20188330 TGCCTCCCTCCAGGGAAGGGTGG + Intergenic
927443757 2:23139900-23139922 TGGCACCCTGCTTGGGAGTGAGG - Intergenic
929993668 2:46811646-46811668 TGCTTCCCTCCTTGACAAGGGGG - Intergenic
930802483 2:55457298-55457320 CACCTGCCTCCTTTGGAGGGTGG - Intergenic
932416685 2:71577822-71577844 TCCCTGCCTCCTGGGGAAGGTGG + Intronic
933692634 2:85191242-85191264 TAACTCCTTCCTTGGGAGGAAGG - Intronic
934946494 2:98546310-98546332 TGCATCCCTCCTTGGGAAGAAGG - Intronic
936528533 2:113258856-113258878 TGAAGCCCTTCTTGGGAGGGAGG - Intronic
937821280 2:126313630-126313652 TGCCTCCCTCCTTGTTTGGATGG - Intergenic
941856900 2:170240478-170240500 TGCTTCCCTCCTTTTCAGGGAGG + Intronic
942748820 2:179264941-179264963 TGCCTCCCGCCTGGGGAGCCTGG - Intergenic
942928231 2:181457939-181457961 CTCCTGCCTCCTTGGGAGGGAGG - Intronic
943100364 2:183479359-183479381 TACCTCCCTCCTGGGCGGGGCGG - Intergenic
945607590 2:211955004-211955026 TGAGTCCCTCCTTGCCAGGGTGG - Intronic
947593541 2:231397651-231397673 TGGCGCCCCCCTTGGGAGGCTGG - Intronic
948052427 2:234988637-234988659 GCCCTCCCTCCCTGGCAGGGCGG - Intronic
948267097 2:236642985-236643007 TGCCTCCCTCCAGCTGAGGGAGG + Intergenic
948273120 2:236688869-236688891 TGCTTCCTCCCATGGGAGGGAGG - Intergenic
948890044 2:240903180-240903202 CGCCTCCCTCCCTGGGACTGGGG - Intergenic
1168957973 20:1848104-1848126 TGCTTCCCTCCTGGGGTGGTGGG - Intergenic
1168979985 20:1996069-1996091 TTCCTCCCTCCCTGGGTGGCTGG - Intergenic
1169111802 20:3038890-3038912 AGCCTCCCTCCCTAGGAAGGTGG + Intronic
1169111803 20:3038892-3038914 GGCCACCTTCCTAGGGAGGGAGG - Intronic
1169264093 20:4157216-4157238 TACCTCCCTCCTAGGGTGGCTGG + Intronic
1171486934 20:25491897-25491919 TGCCTCCCTCCTTGGGAGGGAGG - Intronic
1171533289 20:25866058-25866080 TGACTTCCACCTTGGGAGGAAGG + Intronic
1171854845 20:30334660-30334682 GGCATCCCTCCTTGGCTGGGAGG + Intergenic
1171861559 20:30405809-30405831 AGCCGCCCTGCCTGGGAGGGAGG + Intergenic
1172024427 20:31938276-31938298 TGCCCACCTCCTAGGGAGTGGGG + Intronic
1172095538 20:32458369-32458391 TGCCTCCTTCCTAGGGACAGTGG - Intronic
1172772878 20:37391968-37391990 TGCCTTCCTCCCTTGCAGGGTGG + Intronic
1175990178 20:62784770-62784792 TGCCTCCCTCCCTCGCAGCGTGG - Intergenic
1176238323 20:64064430-64064452 TGCCTGCCTCCTGGGGGGTGGGG + Intronic
1176715058 21:10343265-10343287 TGCCTGCCTCCTGGGGAGCCCGG - Intergenic
1178284836 21:31316871-31316893 GGCCTCCCTCCCTGGGGGGCAGG - Intronic
1179819502 21:43928487-43928509 TGCCTCCCGCCTGGGGACAGAGG + Intronic
1179889631 21:44328981-44329003 TGTCTGCCTCCTTGGGACTGTGG - Intronic
1179898605 21:44377361-44377383 TGCCTGCTTTCTTGGGAGGGAGG - Intronic
1180484676 22:15784383-15784405 TGCCTGCCTCCTGGGGAGCCCGG + Intergenic
1180603290 22:17036673-17036695 TGCCTGCCTCCTGGGGAGCCCGG + Intergenic
1180831344 22:18908105-18908127 TGCCTGCCTTCTGGGGAAGGGGG - Intronic
1181027309 22:20133355-20133377 GGCCTCTGTCCTTGGGCGGGGGG + Intronic
1181068514 22:20318261-20318283 TGCCTGCCTTCTGGGGAAGGGGG + Intronic
1181486068 22:23232480-23232502 TGCCTGGCTCTTTGGGAGTGGGG + Intronic
1181921175 22:26321569-26321591 TCACTCCCTCTGTGGGAGGGAGG - Intronic
1182295126 22:29307784-29307806 CGCCTCCCTGCCTGAGAGGGAGG + Intronic
1182356500 22:29724576-29724598 TGCCTCCCTGGCTGGGAAGGTGG + Intronic
1182788264 22:32926199-32926221 TGCTTCCCTATTTGGTAGGGTGG - Intronic
1182896781 22:33865506-33865528 TGCCACCCTCCTTGGTAAAGGGG - Intronic
1183256737 22:36767215-36767237 TGCATCTCTCCTAGGGAGGATGG + Intronic
1185272105 22:49934510-49934532 TGCCTGCCACCTGGGAAGGGTGG + Intergenic
1203281428 22_KI270734v1_random:133376-133398 TGCCTGCCTTCTGGGGAAGGGGG - Intergenic
950424800 3:12919352-12919374 TGCCACCTCCCTTGGGAGGCAGG - Intronic
950452350 3:13072508-13072530 TGCCTCCGTGCTAGGGACGGTGG + Intronic
950580040 3:13856014-13856036 TCTCCCCCTCCTGGGGAGGGAGG - Intronic
953436643 3:42882494-42882516 TCCCTAGCCCCTTGGGAGGGTGG + Intronic
953979291 3:47405736-47405758 TGCAGCGCTCCTGGGGAGGGAGG - Exonic
954332357 3:49897798-49897820 TGCCTCCCTCCATGGAAGGAAGG + Intronic
954672862 3:52299847-52299869 TGCCTCCATCCCAGGGAGGAGGG + Intergenic
954672863 3:52299849-52299871 TGCCCTCCTCCCTGGGATGGAGG - Intergenic
954693281 3:52407115-52407137 TGCCTACCTCCTAGGGAGCTGGG - Intronic
955948305 3:64216826-64216848 TGCCTGCCTCATTAGGAAGGAGG - Intronic
959063351 3:101635041-101635063 TGCCTCTCTCAGTGGGAGGAGGG - Intergenic
960639799 3:119814240-119814262 TGCCTCCTTACTGGGGAGGTGGG + Intronic
960747677 3:120908165-120908187 TGCCTCCCACGGCGGGAGGGCGG + Exonic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
961493495 3:127274070-127274092 TGCAGCCCTGCCTGGGAGGGTGG - Intergenic
961539008 3:127587995-127588017 GGCCTCCAACCCTGGGAGGGAGG + Intronic
962032753 3:131618788-131618810 TGTCTCTCTCCTTGGGAATGGGG - Intronic
963123632 3:141796158-141796180 TGACTCCCTGCATGGGAGAGTGG + Intronic
964255155 3:154766974-154766996 TGCCGCCCCACCTGGGAGGGTGG + Intergenic
964419487 3:156486452-156486474 TGCCACCCTGGTTGGGATGGGGG + Intronic
966182069 3:177197148-177197170 TGCCTCCATTCCCGGGAGGGGGG - Intronic
966196880 3:177322746-177322768 AGCTTCCCTCCGTTGGAGGGTGG + Intergenic
966749610 3:183309565-183309587 TGCCTCTCTCCTTGGGATCCTGG + Intronic
968232158 3:197010579-197010601 TGCCTCTCTCCTGGGGATAGTGG - Intronic
968441664 4:627536-627558 TGCCCCACTTCTTAGGAGGGAGG - Intronic
969874165 4:10123714-10123736 TGCCTCCCTGTGGGGGAGGGGGG + Intergenic
974277102 4:59736066-59736088 GGCCTCTCTCCTTGGCAGGCAGG - Intergenic
976915887 4:90374395-90374417 CGCCTCCTTTTTTGGGAGGGGGG + Intronic
981758072 4:148162766-148162788 TGCCTCCCTGCCAGGGTGGGTGG + Intronic
982139566 4:152304941-152304963 TCCCTCCTTCTTTGGGAGAGAGG + Intergenic
982668376 4:158292828-158292850 TGCCAACCTTCTTGGAAGGGTGG + Intergenic
983523032 4:168730708-168730730 AGCCACCTTCCTTGGGATGGTGG + Intronic
986764976 5:10917204-10917226 TGCCCCCCGCCTTGGGAAAGGGG - Intergenic
987076051 5:14382611-14382633 TCCCTCCCTGCAGGGGAGGGTGG - Intronic
991345335 5:65659845-65659867 TTCCTAGCTCCTTGGGAGAGAGG + Intronic
992827907 5:80568614-80568636 TGCCCCTTTCCTTGGGTGGGAGG - Intronic
998140631 5:139697635-139697657 TCCCTCCCTCCGTGGGATGGAGG + Intergenic
998651247 5:144124135-144124157 TGCATTCCTCCTTTAGAGGGTGG + Intergenic
998965701 5:147538417-147538439 TGCCTCCCTCCTGGTGGGAGTGG + Intergenic
999195268 5:149777539-149777561 TCCCTGCCTGCGTGGGAGGGTGG - Intronic
1000285102 5:159819957-159819979 TGCCCTCCTCCTAGGGATGGGGG + Intergenic
1002081174 5:176738376-176738398 TGCCTCACTGCTTGGGAGTCTGG + Intergenic
1002279632 5:178122804-178122826 TCCCTCCCTCCATAGGAGTGGGG + Exonic
1002830350 6:814868-814890 TCCTTCCTGCCTTGGGAGGGAGG - Intergenic
1002878591 6:1232931-1232953 TGCTTCCCACCTTGGGAGAGAGG + Intergenic
1004190756 6:13461557-13461579 TGCCACCCTGCTGCGGAGGGTGG - Intronic
1004457529 6:15804775-15804797 TGTCTCCCTCCCTGGAAGGAAGG + Intergenic
1006586827 6:35120521-35120543 TGGCTGCCTCATTGGGAGAGGGG + Exonic
1008054914 6:46936232-46936254 GGCCTTCCTCCCTGGGATGGGGG + Intronic
1010350292 6:74865633-74865655 TGTTTCTTTCCTTGGGAGGGAGG - Intergenic
1010653330 6:78480431-78480453 TGCCTTCCTCTTATGGAGGGTGG - Intergenic
1011131078 6:84052318-84052340 TGCCTCCCTCACTGCGTGGGTGG + Intronic
1013857459 6:114591398-114591420 TGCCTCCTCCCTTGGGCTGGGGG + Intergenic
1015085071 6:129280866-129280888 TGCCACCCTTCCTGGGAGGGAGG + Intronic
1019299023 7:294219-294241 TGCTTCCATCTGTGGGAGGGAGG - Intergenic
1019477259 7:1249911-1249933 AGCCTCACTCCCTGGGAGGCCGG - Intergenic
1019564700 7:1673559-1673581 TTCCAGCCTCCTGGGGAGGGAGG + Intergenic
1019636880 7:2080811-2080833 CGTCTCCCTCCCTGGCAGGGAGG - Intronic
1021885548 7:25134553-25134575 TGCCTACCTCCATGCAAGGGTGG - Intergenic
1022746517 7:33178333-33178355 TTCCTCCCACCTTGGCAGAGGGG + Intronic
1024216589 7:47254163-47254185 TGACCCCTTCCTTGGGAGGGGGG + Intergenic
1026832011 7:73616034-73616056 TCCCTCCCGGCTTGGGAGGCTGG + Intronic
1026874962 7:73873976-73873998 TGCCTCCCTCCCAGGGAGACTGG - Intergenic
1028136721 7:87230426-87230448 TGCCTACCAGCATGGGAGGGAGG + Intergenic
1029284545 7:99456769-99456791 TGCCTCCCTCCCTGGATGAGGGG - Exonic
1029497177 7:100902285-100902307 CACCTCTCTCCTTGGAAGGGAGG - Intergenic
1029614613 7:101648453-101648475 TGCCTGCCACCTTGGGGGAGTGG - Intergenic
1029794645 7:102881317-102881339 TGCCTGTCTACTTGGGAGGCTGG + Intronic
1032811044 7:135417907-135417929 AGCATTCCACCTTGGGAGGGAGG - Intronic
1034303261 7:150033921-150033943 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1034303665 7:150035451-150035473 TGCCTCCCCCGTTGCGATGGGGG + Intergenic
1034304119 7:150037151-150037173 TGCCTCCCCCCCTGTGATGGGGG + Intergenic
1034304348 7:150037926-150037948 TGCCTCCCCCCCTGCGATGGCGG + Intergenic
1034304748 7:150039435-150039457 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1034305330 7:150041796-150041818 TGCCTCCCCCCCTGCGATGGGGG + Intergenic
1034780888 7:153881557-153881579 TGTCTCCCTGCTTTGGAGGGTGG + Intergenic
1034801298 7:154058149-154058171 TGCCTCCCCCCCTGCGATGGTGG - Intronic
1034801324 7:154058227-154058249 TGCCTCCCCCCCTGCGATGGGGG - Intronic
1034801832 7:154060080-154060102 TGCCTCCCCCCCTGCGATGGTGG - Intronic
1034801855 7:154060157-154060179 TGCCTCCCCCCCTGCGATGGGGG - Intronic
1034802022 7:154060705-154060727 TGCCTCCCCCCCTGCGATGGGGG - Intronic
1034802252 7:154061687-154061709 TGCCTCCCCCCCTGCGATGGTGG - Intronic
1034802276 7:154061765-154061787 TGCCTCCCTCCCTGCGATGGGGG - Intronic
1034802702 7:154063105-154063127 TGCCTCCCCCCCTGCGATGGGGG - Intronic
1034802860 7:154063589-154063611 TGCCTCCCTCACTGCGATGGGGG - Intronic
1034978592 7:155461717-155461739 TACTTCCCTCCTTGGTGGGGAGG - Intronic
1035185789 7:157125187-157125209 TTCCTCCTTCCTCGGGAGGAAGG - Intergenic
1037767748 8:21782404-21782426 TGCCACCCTCCTAGGTGGGGCGG + Intronic
1037817221 8:22118619-22118641 TGCCTGCCTCATGGGGCGGGGGG + Intronic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1039593744 8:38771855-38771877 GTCCTCACTACTTGGGAGGGAGG - Intronic
1041095505 8:54344957-54344979 GGCCTCCCTCCCTGGGTAGGAGG - Intergenic
1041272651 8:56124185-56124207 TGCCTCCTTTTTTGGGAGGCAGG + Intergenic
1042759109 8:72251814-72251836 CGCCTCCCTCTTTGCTAGGGAGG - Intergenic
1044356223 8:91225390-91225412 TGCCTCCCTTCTCTGGTGGGAGG + Intronic
1048344896 8:133569134-133569156 TGCCTACCTCCCTGGCTGGGAGG - Intronic
1048862676 8:138735876-138735898 TCCGTCCCTCGTTGGCAGGGAGG - Intronic
1049379258 8:142303875-142303897 TGCATCCCTCCTGGGGTGGCCGG - Intronic
1049411034 8:142474150-142474172 TGCCTCCCTCAGTGGGAGTGTGG - Intronic
1049917671 9:334338-334360 TGTCTCCACCCTTGAGAGGGAGG + Exonic
1050821945 9:9890014-9890036 TCCATGCCTCTTTGGGAGGGTGG - Intronic
1051169067 9:14300321-14300343 TCCCTCCATCCTTGTGAAGGAGG - Intronic
1051366710 9:16326546-16326568 TGCCAGCCTCCTTGGGACTGTGG + Intergenic
1052665202 9:31487126-31487148 GGCCTCCCTTTTTGGCAGGGTGG - Intergenic
1053792669 9:41697943-41697965 GGCATCCCTCCTTGGCTGGGAGG + Intergenic
1054152511 9:61616877-61616899 GGCATCCCTCCTTGGCTGGGAGG - Intergenic
1054181082 9:61909964-61909986 GGCATCCCTCCTTGGCTGGGAGG + Intergenic
1054472281 9:65548025-65548047 GGCATCCCTCCTTGGCTGGGAGG - Intergenic
1054656509 9:67671178-67671200 GGCATCCCTCCTTGGCTGGGAGG - Intergenic
1055168158 9:73222055-73222077 TGCATGCCTCCTTGGAAGGAAGG + Intergenic
1056385967 9:86097782-86097804 TCCCTCCTTCCTGGGGAAGGTGG + Intronic
1056657789 9:88523240-88523262 GGCCACCTTCCTGGGGAGGGAGG + Intergenic
1058385037 9:104426519-104426541 TGACTATATCCTTGGGAGGGAGG - Intergenic
1058424503 9:104864725-104864747 TGCCACCCTGCTTGGGAAGGAGG - Intronic
1058456573 9:105143357-105143379 TGGCTCCCTCCTTCACAGGGGGG - Intergenic
1059312404 9:113397394-113397416 AGTCTTCCTCCTTGGTAGGGTGG + Intronic
1059337682 9:113579510-113579532 AGACCCCCACCTTGGGAGGGTGG + Intronic
1059341794 9:113601475-113601497 TGCCCCCTTCCTTGGGTGGGAGG + Intergenic
1059449619 9:114362329-114362351 TGCCTCCCTCCTGGAGACTGAGG + Intronic
1060555830 9:124506772-124506794 GGCTTCCCTCCCTGGGTGGGTGG - Intronic
1060943716 9:127557863-127557885 TGCCACCCTCCTTGAGAGATGGG + Intronic
1061041693 9:128144498-128144520 AGCCTCCCTCTTTGGGGGAGGGG - Intergenic
1061872129 9:133526777-133526799 TGCCTCCCTGCAGGGGAGGTGGG - Intronic
1062385163 9:136306399-136306421 AGCCTCCCTCCCTGGGGGGACGG + Intronic
1062423320 9:136494390-136494412 TGGCTCCCTTTCTGGGAGGGAGG - Intergenic
1062526836 9:136981325-136981347 GGCCTCCCTCCTGGGGGTGGTGG - Intronic
1186169493 X:6861835-6861857 TGCCTCCTTCCCTGGGGTGGGGG - Intergenic
1187047959 X:15666562-15666584 TTTCTCCCTCCTTGCGAGGGTGG + Intergenic
1188308148 X:28584526-28584548 TTCCACCCTCCTTTGGAGGGAGG + Intergenic
1188642839 X:32527883-32527905 TGTCTCCCTCTGTGGAAGGGGGG + Intronic
1189160240 X:38803579-38803601 TGCCTCCCTCCTGGCGGGGTGGG - Exonic
1191741021 X:64434976-64434998 TGCTTCCCTTTCTGGGAGGGGGG + Intergenic
1193565959 X:83077359-83077381 TCTCTCCCTCCTTGGGAAGGAGG + Intergenic
1195485181 X:105396606-105396628 TGCTTCCTTCCTTGGGAGAGAGG - Intronic
1195676207 X:107509000-107509022 TTCCTACCTCCTGGGGAGGGAGG + Intergenic
1198040648 X:132848316-132848338 TGCATCCCTCCTGGGTAGGATGG + Intronic
1198234868 X:134727173-134727195 AGCCTCCCTACTTTTGAGGGAGG - Intronic
1199711563 X:150473315-150473337 TGCCTCCCTCTTCTGGAGAGTGG + Intronic
1201559825 Y:15304123-15304145 TGCCTCCTTCCCTGGGGTGGGGG - Intergenic